ID: 1123746080 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:23320970-23320992 |
Sequence | AGCGGGGCAGTTTCCTTACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1123746072_1123746080 | 6 | Left | 1123746072 | 15:23320941-23320963 | CCACTCTGGACAGCACCATTTCC | No data | ||
Right | 1123746080 | 15:23320970-23320992 | AGCGGGGCAGTTTCCTTACAGGG | No data | ||||
1123746076_1123746080 | -9 | Left | 1123746076 | 15:23320956-23320978 | CCATTTCCAGCCTCAGCGGGGCA | No data | ||
Right | 1123746080 | 15:23320970-23320992 | AGCGGGGCAGTTTCCTTACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1123746080 | Original CRISPR | AGCGGGGCAGTTTCCTTACA GGG | Intergenic | ||