ID: 1123746081

View in Genome Browser
Species Human (GRCh38)
Location 15:23320982-23321004
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123746072_1123746081 18 Left 1123746072 15:23320941-23320963 CCACTCTGGACAGCACCATTTCC No data
Right 1123746081 15:23320982-23321004 TCCTTACAGGGAAGTTAATGAGG No data
1123746078_1123746081 -7 Left 1123746078 15:23320966-23320988 CCTCAGCGGGGCAGTTTCCTTAC No data
Right 1123746081 15:23320982-23321004 TCCTTACAGGGAAGTTAATGAGG No data
1123746077_1123746081 -3 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746081 15:23320982-23321004 TCCTTACAGGGAAGTTAATGAGG No data
1123746076_1123746081 3 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746081 15:23320982-23321004 TCCTTACAGGGAAGTTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123746081 Original CRISPR TCCTTACAGGGAAGTTAATG AGG Intergenic