ID: 1123746082

View in Genome Browser
Species Human (GRCh38)
Location 15:23320983-23321005
Sequence GCCTCATTAACTTCCCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123746082_1123746084 -6 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746084 15:23321000-23321022 TGAGGCACTAACGAAGGCTCAGG No data
1123746082_1123746091 23 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746091 15:23321029-23321051 GGGGAACCTCTATCGAGAAGAGG No data
1123746082_1123746089 3 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746089 15:23321009-23321031 AACGAAGGCTCAGGGGACAGGGG No data
1123746082_1123746085 -5 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746085 15:23321001-23321023 GAGGCACTAACGAAGGCTCAGGG No data
1123746082_1123746088 2 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746088 15:23321008-23321030 TAACGAAGGCTCAGGGGACAGGG No data
1123746082_1123746086 -4 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746086 15:23321002-23321024 AGGCACTAACGAAGGCTCAGGGG No data
1123746082_1123746090 4 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746090 15:23321010-23321032 ACGAAGGCTCAGGGGACAGGGGG No data
1123746082_1123746087 1 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746087 15:23321007-23321029 CTAACGAAGGCTCAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123746082 Original CRISPR GCCTCATTAACTTCCCTGTA AGG (reversed) Intergenic