ID: 1123746089

View in Genome Browser
Species Human (GRCh38)
Location 15:23321009-23321031
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123746082_1123746089 3 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746089 15:23321009-23321031 AACGAAGGCTCAGGGGACAGGGG No data
1123746076_1123746089 30 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746089 15:23321009-23321031 AACGAAGGCTCAGGGGACAGGGG No data
1123746077_1123746089 24 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746089 15:23321009-23321031 AACGAAGGCTCAGGGGACAGGGG No data
1123746078_1123746089 20 Left 1123746078 15:23320966-23320988 CCTCAGCGGGGCAGTTTCCTTAC No data
Right 1123746089 15:23321009-23321031 AACGAAGGCTCAGGGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123746089 Original CRISPR AACGAAGGCTCAGGGGACAG GGG Intergenic