ID: 1123746090

View in Genome Browser
Species Human (GRCh38)
Location 15:23321010-23321032
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123746077_1123746090 25 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746090 15:23321010-23321032 ACGAAGGCTCAGGGGACAGGGGG No data
1123746082_1123746090 4 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746090 15:23321010-23321032 ACGAAGGCTCAGGGGACAGGGGG No data
1123746078_1123746090 21 Left 1123746078 15:23320966-23320988 CCTCAGCGGGGCAGTTTCCTTAC No data
Right 1123746090 15:23321010-23321032 ACGAAGGCTCAGGGGACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123746090 Original CRISPR ACGAAGGCTCAGGGGACAGG GGG Intergenic