ID: 1123746091

View in Genome Browser
Species Human (GRCh38)
Location 15:23321029-23321051
Sequence GGGGAACCTCTATCGAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123746082_1123746091 23 Left 1123746082 15:23320983-23321005 CCTTACAGGGAAGTTAATGAGGC No data
Right 1123746091 15:23321029-23321051 GGGGAACCTCTATCGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123746091 Original CRISPR GGGGAACCTCTATCGAGAAG AGG Intergenic