ID: 1123747023

View in Genome Browser
Species Human (GRCh38)
Location 15:23326356-23326378
Sequence GTTGCAGGAGACCCGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123747023_1123747030 -4 Left 1123747023 15:23326356-23326378 CCCTCAACCGGGTCTCCTGCAAC No data
Right 1123747030 15:23326375-23326397 CAACTATTGGTGGGCCATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123747023 Original CRISPR GTTGCAGGAGACCCGGTTGA GGG (reversed) Intergenic
No off target data available for this crispr