ID: 1123750374

View in Genome Browser
Species Human (GRCh38)
Location 15:23354550-23354572
Sequence CTCCCCTCTCTTAGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123750369_1123750374 -6 Left 1123750369 15:23354533-23354555 CCCAGAGTTGGCGGCCTCTCCCC No data
Right 1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG No data
1123750362_1123750374 6 Left 1123750362 15:23354521-23354543 CCCTGCCCCTCTCCCAGAGTTGG No data
Right 1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG No data
1123750367_1123750374 0 Left 1123750367 15:23354527-23354549 CCCTCTCCCAGAGTTGGCGGCCT No data
Right 1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG No data
1123750366_1123750374 1 Left 1123750366 15:23354526-23354548 CCCCTCTCCCAGAGTTGGCGGCC No data
Right 1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG No data
1123750364_1123750374 5 Left 1123750364 15:23354522-23354544 CCTGCCCCTCTCCCAGAGTTGGC No data
Right 1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG No data
1123750370_1123750374 -7 Left 1123750370 15:23354534-23354556 CCAGAGTTGGCGGCCTCTCCCCT No data
Right 1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG No data
1123750361_1123750374 10 Left 1123750361 15:23354517-23354539 CCGGCCCTGCCCCTCTCCCAGAG No data
Right 1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG No data
1123750368_1123750374 -1 Left 1123750368 15:23354528-23354550 CCTCTCCCAGAGTTGGCGGCCTC No data
Right 1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123750374 Original CRISPR CTCCCCTCTCTTAGAGTGGG TGG Intergenic
No off target data available for this crispr