ID: 1123750485

View in Genome Browser
Species Human (GRCh38)
Location 15:23355078-23355100
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 7, 1: 4, 2: 42, 3: 30, 4: 297}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123750473_1123750485 29 Left 1123750473 15:23355026-23355048 CCCACCAAAGTTTTGCCAGTCAG 0: 4
1: 9
2: 10
3: 21
4: 130
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750476_1123750485 14 Left 1123750476 15:23355041-23355063 CCAGTCAGCCCCACCCCTTCAGC 0: 4
1: 0
2: 4
3: 39
4: 395
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750481_1123750485 0 Left 1123750481 15:23355055-23355077 CCCTTCAGCAAGCAGCCCAGTCT 0: 6
1: 20
2: 7
3: 20
4: 193
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750474_1123750485 28 Left 1123750474 15:23355027-23355049 CCACCAAAGTTTTGCCAGTCAGC 0: 4
1: 9
2: 8
3: 19
4: 107
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750472_1123750485 30 Left 1123750472 15:23355025-23355047 CCCCACCAAAGTTTTGCCAGTCA 0: 4
1: 9
2: 9
3: 20
4: 131
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750478_1123750485 5 Left 1123750478 15:23355050-23355072 CCCACCCCTTCAGCAAGCAGCCC 0: 21
1: 10
2: 6
3: 38
4: 321
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750479_1123750485 4 Left 1123750479 15:23355051-23355073 CCACCCCTTCAGCAAGCAGCCCA 0: 25
1: 7
2: 4
3: 36
4: 273
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750480_1123750485 1 Left 1123750480 15:23355054-23355076 CCCCTTCAGCAAGCAGCCCAGTC 0: 22
1: 8
2: 6
3: 20
4: 185
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750477_1123750485 6 Left 1123750477 15:23355049-23355071 CCCCACCCCTTCAGCAAGCAGCC 0: 21
1: 10
2: 5
3: 31
4: 333
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750482_1123750485 -1 Left 1123750482 15:23355056-23355078 CCTTCAGCAAGCAGCCCAGTCTC 0: 6
1: 15
2: 6
3: 30
4: 260
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297
1123750475_1123750485 25 Left 1123750475 15:23355030-23355052 CCAAAGTTTTGCCAGTCAGCCCC 0: 4
1: 9
2: 6
3: 27
4: 122
Right 1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG 0: 7
1: 4
2: 42
3: 30
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900104801 1:977272-977294 CTGCCCCCACCGACCAACCCCGG + Intronic
900105007 1:977716-977738 CTGCCCCCACCGACCAACCCCGG + Intronic
900105115 1:977952-977974 CTGCCCCCACCGACCAACCCCGG + Intronic
900808457 1:4783314-4783336 ATTCCATCACCATTCACCCCAGG + Exonic
900995704 1:6122179-6122201 CTGGCCTCACCCATCACCATGGG + Intronic
901126698 1:6934449-6934471 CTGCCCTTACCCATCCTCCCAGG - Intronic
901479276 1:9513446-9513468 CTGACCTGACCAATCAGCACTGG + Intergenic
902637220 1:17742480-17742502 CTGCTCTGACCACTCACCCAGGG - Intergenic
902703181 1:18186817-18186839 CTGCCCTCACCTAACTTCCCTGG + Intronic
903125126 1:21242592-21242614 CAGCCTTCACCCATCAGCCCTGG + Intronic
904569850 1:31455187-31455209 CTTCCATCACTCATCACCCCAGG + Intergenic
905318246 1:37097212-37097234 CAGCCCTCTCACATCACCCCAGG - Intergenic
906545162 1:46615252-46615274 CTCCCCACACCAACCACCCTGGG + Intronic
909904050 1:81174810-81174832 CTGCCCTGCCCCATCATCCCAGG - Intergenic
912821878 1:112874385-112874407 CTCACCTCACCCCTCACCCCAGG - Intergenic
913503013 1:119489088-119489110 CTACCCTCAGCACTCATCCCAGG + Intergenic
920276511 1:204809220-204809242 CTTCCCCAACCACTCACCCCAGG + Intergenic
920927857 1:210359577-210359599 CCGACCTGACCAATCAGCCCTGG + Intronic
923091963 1:230747704-230747726 CTGCTCGCCCCACTCACCCCTGG - Exonic
923877333 1:238063257-238063279 CTGCCCTCACAATGAACCCCAGG - Intergenic
1062982125 10:1733826-1733848 CTGCCATCACTAAATACCCCTGG - Intronic
1065219314 10:23480070-23480092 CTGCCCTCTACTATCACCCCTGG + Intergenic
1065918904 10:30374096-30374118 CTGCCCTCAGCAGTCACCCCTGG - Intronic
1069513370 10:69058269-69058291 CTGCCCATACCAGGCACCCCAGG - Intergenic
1070599794 10:77857575-77857597 CAGCCCTCATCAACCACCCTAGG + Intronic
1073267845 10:102239130-102239152 TTGCCCTCACCAGCAACCCCTGG + Intronic
1073936668 10:108640659-108640681 CTACCCCCACCAAACTCCCCTGG - Intergenic
1075136731 10:119793450-119793472 CTTCCATCACCAAACACTCCAGG - Intronic
1076208306 10:128620888-128620910 GTGACCTCACCATTCACCCAGGG + Intergenic
1076208517 10:128622605-128622627 GTGACCTCACCACTCACCCAGGG + Intergenic
1076806646 10:132862288-132862310 CTGCCCTCAACAAGCCCCGCAGG - Intronic
1076852354 10:133099296-133099318 CTGCCCCCACCACTCTCTCCGGG - Intronic
1081831530 11:46120015-46120037 CTGCCTGCACCCCTCACCCCGGG - Intronic
1083142465 11:60733417-60733439 CCCCCAACACCAATCACCCCTGG + Intronic
1083275446 11:61594564-61594586 CTGCCCTCACCCACCACCCCAGG - Intergenic
1083669801 11:64293233-64293255 CAGCTGTCACCCATCACCCCTGG + Intronic
1083793629 11:65001941-65001963 CTGCCCTTGCCAATCTCACCTGG - Intergenic
1084640577 11:70423587-70423609 CTGCCCTCAGAAATGAGCCCAGG - Intronic
1084888342 11:72224568-72224590 CTGCCCCCATCATTCACCCGAGG - Intronic
1085351963 11:75803334-75803356 CTGCCCTCACCACTACACCCAGG - Intergenic
1085387959 11:76167985-76168007 CTGCCCTCCCCTCCCACCCCAGG + Intergenic
1087185400 11:95187319-95187341 ATGCCCTCACCAATCTCTGCAGG + Intronic
1087561594 11:99796917-99796939 CTGCCCTCACAACTGACCCCTGG - Intronic
1089253635 11:117182022-117182044 GAGCCCCCACCAGTCACCCCCGG - Intronic
1089650848 11:119911877-119911899 CTGCCCCCACCAGTCACTCATGG - Intergenic
1090752957 11:129763550-129763572 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1091285407 11:134405895-134405917 CAGCCCTCACCTTCCACCCCTGG + Intronic
1091751272 12:3022587-3022609 CTGCCCTCCCACCTCACCCCGGG + Intronic
1091763771 12:3104993-3105015 CTGCCCTCACCCCTCTCCCAGGG - Intronic
1092171170 12:6374905-6374927 GTGCCCTCTCCCATCACCCCTGG + Exonic
1094052628 12:26237937-26237959 CTGCTCTCTACAATCACACCTGG - Intronic
1094159729 12:27377882-27377904 CTGCCCCAACCATTCACCCTCGG - Intronic
1094556426 12:31504733-31504755 CTGCCCTGACAGATAACCCCAGG + Intronic
1095949472 12:47773881-47773903 CTGCCCTCACCCAGCACCCAGGG - Intronic
1097707543 12:62883333-62883355 CTGCCCCCACCCATTACCCCCGG + Intronic
1099697965 12:86044936-86044958 CTGCCCTCACCATGAACCTCTGG - Intronic
1100982542 12:100172920-100172942 CTGCCCTCACCAGTCGCACCAGG - Intergenic
1102236797 12:111298756-111298778 CTGCCCTCCCCAAGCTCCCAGGG + Intronic
1102390792 12:112547098-112547120 CAGCCCTCTCCAACCACCCACGG - Intergenic
1102482670 12:113234416-113234438 CTGCCCTCAGCAAGCCCACCTGG - Intronic
1103555066 12:121761366-121761388 CTTCCCTGACCACTCAGCCCAGG - Intronic
1105205166 13:18217207-18217229 CTGCCCTCAGCACTCAGCCTTGG + Intergenic
1106186232 13:27412415-27412437 CTGCCCTTACCAGTTTCCCCTGG - Intergenic
1108083580 13:46762019-46762041 CTGCCCTCACCAATGAGGGCGGG + Intergenic
1108459109 13:50647353-50647375 CTGCCCTCCCCTCTCACCACAGG - Intronic
1111676976 13:91399347-91399369 CTACCCGCACCAAGCATCCCCGG - Intronic
1114852930 14:26402166-26402188 CTGCCCCCACCTCCCACCCCAGG + Intergenic
1118321222 14:64754446-64754468 CTGCCTTCCGCAATCACCTCAGG + Intronic
1118373737 14:65159092-65159114 CTGCCCTCACCAATGTTCCCTGG + Intergenic
1122443909 14:101755428-101755450 CAGACATCACCAATGACCCCTGG + Intergenic
1122497247 14:102166883-102166905 CTGCCCTCACTCATCTCACCTGG + Intronic
1122750217 14:103927860-103927882 CTGCCCTCCCCTATAACCCTGGG + Intronic
1123133719 14:106008624-106008646 ATGCCATCACCTATCAACCCAGG - Intergenic
1123469728 15:20541206-20541228 CTGCCCTCACCAGTTGCCACAGG - Intronic
1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123472094 15:20562861-20562883 CCACCCTCACCAGTCATCCCTGG + Intergenic
1123573809 15:21644486-21644508 TTGCCTTCCCTAATCACCCCAGG - Intergenic
1123583740 15:21739052-21739074 ATGCCATCACCTATCAACCCAGG - Intergenic
1123610427 15:22087071-22087093 TTGCCTTCCCTAATCACCCCAGG - Intergenic
1123620390 15:22181655-22181677 ATGCCATCACCTATCAACCCAGG - Intergenic
1123645909 15:22437492-22437514 CCACCCTCACCAGTCATCCCTGG - Intergenic
1123645957 15:22437648-22437670 CTGCCCTCACCAATCACCCCAGG - Intergenic
1123648335 15:22459493-22459515 CTGCCCTCACCAGTTGCCACAGG + Intronic
1123667226 15:22617361-22617383 CCACCCTCGCCAATCATCCCTGG - Intergenic
1123667266 15:22617502-22617524 TTGCCCTCGCCAATCACCCCAGG - Intergenic
1123682924 15:22775624-22775646 CTGCCCTCACCAGTCACCCCAGG - Intronic
1123682961 15:22775773-22775795 CTGCCCTCACCGGTCACCCCAGG - Intronic
1123730006 15:23136192-23136214 CTGCCCTCACCAGTTGCCACAGG - Intronic
1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123732398 15:23157852-23157874 CCACCCTCACCAGTCATCCCTGG + Intergenic
1123748176 15:23333674-23333696 CTGCCCTCACCAGTTGCCACAGG - Intergenic
1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG + Intronic
1123750533 15:23355234-23355256 CCACCCTCACCAGTCATCCCTGG + Intronic
1123762946 15:23446746-23446768 CTGCCCTCACCAGTCGCCCCAGG - Intronic
1124280540 15:28357526-28357548 CTGCCCTCACCAGTTGCCACAGG - Intergenic
1124282854 15:28378994-28379016 CTGCCCTCACCAATCACCCCAGG + Intronic
1124282902 15:28379150-28379172 CCACCCTCACCAGTCATCCCTGG + Intronic
1124299797 15:28532463-28532485 CCACCCTCACCAGTCATCCCTGG - Intronic
1124299845 15:28532619-28532641 CTGCCCTCACCAATCACCCCAGG - Intronic
1124302158 15:28554086-28554108 CTGCCCTCACCAGTTGCCACAGG + Intergenic
1124321067 15:28711928-28711950 CCACCCTCGCCAATCATCCCTGG - Intronic
1124321107 15:28712069-28712091 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124334670 15:28848147-28848169 CTGCCCTCACCAGTCACCCCAGG - Intergenic
1124334708 15:28848296-28848318 CTGCCCTCACCGGTCACCCCAGG - Intergenic
1124481391 15:30083286-30083308 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124487846 15:30135382-30135404 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124522203 15:30413908-30413930 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124536462 15:30552310-30552332 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124542935 15:30604359-30604381 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124562936 15:30791943-30791965 CCGCCCTCGCCAGTCATCCCTGG + Intergenic
1124592157 15:31063172-31063194 CTGCCATCACAAATCACCACAGG + Exonic
1124755683 15:32402939-32402961 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124762189 15:32455282-32455304 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124776440 15:32593786-32593808 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124960419 15:34389436-34389458 CTGCCCTCGCCGATCACCCCGGG - Intronic
1124977048 15:34535657-34535679 CTGCCCTCGCCGATCACCCCGGG - Intronic
1125541208 15:40471098-40471120 CTCCCCTCCCCAACTACCCCCGG + Exonic
1126300988 15:47195956-47195978 CTGCCTTCACCCACCACCACTGG + Intronic
1127587135 15:60389095-60389117 CTGGCCTTAACTATCACCCCTGG + Intronic
1128980725 15:72183918-72183940 CTGTCCTCACCATCCATCCCTGG - Intronic
1129029062 15:72605441-72605463 CTGCCCTCAACAGTCACCCCAGG + Intergenic
1129474505 15:75775862-75775884 CTGCCCTCACCAACCACCCCAGG + Intergenic
1129474551 15:75776016-75776038 CTCCCGTCACCAGTCATCCCTGG + Intergenic
1129838269 15:78727447-78727469 CTGCCCTCACCAATCACCCCAGG + Intronic
1129838316 15:78727602-78727624 CCACCCTCACCAGTCATCCCTGG + Intronic
1130260263 15:82348931-82348953 CTGCCCTCACCAGTCATCCCTGG - Intronic
1130260314 15:82349086-82349108 CTGCCCTTGCCAATCACCCCAGG - Intronic
1130268416 15:82430347-82430369 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130268467 15:82430502-82430524 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130280970 15:82520076-82520098 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130472340 15:84236257-84236279 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130479831 15:84350828-84350850 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130491939 15:84437301-84437323 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130491988 15:84437456-84437478 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130503553 15:84516341-84516363 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130503604 15:84516496-84516518 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130594638 15:85240893-85240915 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1131258276 15:90875626-90875648 ATGCCCCCACCAGTCAGCCCCGG + Exonic
1131895646 15:97026619-97026641 TTGCCCTCAGCAATCACCTCTGG + Intergenic
1132317167 15:100898533-100898555 CTGCCCTCCCCACTCCTCCCAGG - Intronic
1132433958 15:101781734-101781756 CTGCCCTCACCAATTGCCCCAGG - Intergenic
1202982674 15_KI270727v1_random:378825-378847 TTGCCTTCCCTAATCACCCCAGG - Intergenic
1132695414 16:1199706-1199728 CTCCCCTCAGCCTTCACCCCAGG + Intronic
1132695436 16:1199757-1199779 CTGCCCTCAGCCCTCACCCCTGG + Intronic
1132910332 16:2307183-2307205 CTGCCATCACCAATCAATACAGG + Intronic
1133230072 16:4362235-4362257 CTGCCCACTCCCCTCACCCCAGG + Intronic
1135550894 16:23397481-23397503 CTGCCCTCCCCATTCACCCCTGG - Intronic
1135590177 16:23699418-23699440 ATGCCTTTACCAATCAGCCCAGG - Intronic
1136014143 16:27384052-27384074 CTGCCCTCCCCACCCACACCAGG + Intergenic
1136146200 16:28317903-28317925 CTGCCCTCCCCAGACACTCCTGG - Intronic
1136520871 16:30795004-30795026 CTGCCCTCACCCCCCACCCCAGG + Intergenic
1137578969 16:49621890-49621912 CTGCCCTGTTCACTCACCCCAGG + Intronic
1141877315 16:86834760-86834782 CTGCCCTCAGCAGCCACCGCTGG + Intergenic
1142258838 16:89032774-89032796 CTGCTCTCACGAACCACTCCTGG + Intergenic
1142378114 16:89717174-89717196 CTGCCCCCACCATGGACCCCAGG + Intronic
1143495824 17:7312177-7312199 GTGCCCTCCCCACTCATCCCTGG + Exonic
1144583144 17:16471369-16471391 CTGCCGTAACCAATGACCACTGG - Intronic
1145873854 17:28300704-28300726 CTCCCCTCACCAACCTCCCAGGG + Intergenic
1146002450 17:29139443-29139465 CTGCCCACACAACTCAGCCCTGG + Intronic
1147050362 17:37789888-37789910 CTGCCTGCACCTGTCACCCCAGG - Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1150219308 17:63487129-63487151 GTGCTCTCACCCAGCACCCCCGG - Intronic
1150610813 17:66731655-66731677 CTGCCCTCACGACTCTCACCAGG - Intronic
1151426757 17:74035699-74035721 CTGCCTGCACTAAACACCCCAGG - Intergenic
1152075779 17:78158865-78158887 GTGCCCTCCCCACTCATCCCTGG + Intronic
1152432047 17:80253898-80253920 CCGCCGTCACAGATCACCCCAGG - Intergenic
1152892522 17:82890622-82890644 CCGCCCACACCACTCACGCCAGG - Intronic
1152929395 17:83102142-83102164 CCGCCCTCAGCAAACACCACAGG - Intergenic
1156605722 18:38664823-38664845 CTGCCCTCACAAGTCACACACGG - Intergenic
1157322788 18:46647122-46647144 CAACCCTCCCCAATTACCCCAGG - Intronic
1158512490 18:58103535-58103557 GTGCACTGACCAATCACCCATGG - Intronic
1158701617 18:59753815-59753837 CTTCCCTCACTAATCGCCCAGGG - Intergenic
1158744890 18:60188484-60188506 CTGGCCCCACCCATCACACCTGG - Intergenic
1159938341 18:74386397-74386419 CTGCCCTCTGCAATCACCCAGGG - Intergenic
1160715852 19:576232-576254 CAGCCCTCTCCTAGCACCCCTGG + Intronic
1160777808 19:864322-864344 CTGCCTTCACAAACCACCCTGGG + Intergenic
1160893951 19:1394254-1394276 CTGCCCTCTCCACTGCCCCCGGG - Intronic
1161299322 19:3535244-3535266 AGGCCCCCACCAATCAGCCCTGG - Intronic
1161327674 19:3671363-3671385 CTGACCTCACCAGGCACCTCGGG + Intronic
1161403085 19:4077618-4077640 CTGCCCTCCACCACCACCCCTGG + Intergenic
1161680447 19:5677375-5677397 CTGCCCACCCCATTCCCCCCAGG - Intronic
1161685134 19:5698759-5698781 CGGCCCTCAGCAGACACCCCCGG - Intronic
1162042585 19:7979653-7979675 CTGCCCTCACCAGCCCCCACCGG + Intronic
1162433783 19:10644562-10644584 CTGCCCCCAACAAACACACCAGG - Intergenic
1162509813 19:11111324-11111346 CTGACCTCATCATTCACCACGGG - Intronic
1162940547 19:14006361-14006383 CGGCCGCCGCCAATCACCCCGGG - Intronic
1163266992 19:16227526-16227548 CTACCCTCACCCCTGACCCCAGG + Exonic
1163365029 19:16871100-16871122 CAGCCCTCACCTGCCACCCCTGG - Intronic
1163527965 19:17832752-17832774 CTGCCCTCTCCAACCCACCCTGG + Intronic
1164198038 19:22989911-22989933 CTGCCTTCACTAAAAACCCCAGG + Intronic
1164442991 19:28293459-28293481 CTGCCCACACAAATCAGGCCAGG - Intergenic
1165198403 19:34125197-34125219 CTTCCCTCAACAATCAATCCAGG + Intergenic
1166028945 19:40110984-40111006 CTTCCCTCACCCCCCACCCCCGG - Intergenic
1166719994 19:44991153-44991175 CCGCCCTCACCCACCACACCTGG - Intronic
1166743641 19:45129659-45129681 GTGCCCTCCCCACTCACCCCTGG + Intronic
1166835953 19:45668174-45668196 CCGCCCCCTCCCATCACCCCGGG + Intergenic
1167758624 19:51428993-51429015 CTGCTCTAACAAATTACCCCAGG - Intergenic
1168221666 19:54964949-54964971 CTACCTTCTCCCATCACCCCAGG - Intronic
1168221831 19:54966039-54966061 CTACCTTCTCCCATCACCCCAGG - Exonic
1168232870 19:55044521-55044543 AAGCCCTCAGCAAACACCCCCGG + Exonic
924960030 2:26430-26452 CTGCCTTCCCTAATCACCCCAGG - Intergenic
925262352 2:2539754-2539776 CTGTCCTCACCAAACTCCCAGGG + Intergenic
925360617 2:3278039-3278061 CTGCCCTTCCTAATCATCCCTGG + Intronic
925478628 2:4246635-4246657 CTCCTCGCACCAATCACCCCGGG - Intergenic
925821520 2:7803784-7803806 CTTCCCTCCCCAACCACCCAAGG + Intergenic
926628325 2:15114184-15114206 CTGCCATCACCAAGTACCACAGG + Intergenic
927710549 2:25323077-25323099 CTGACCTCAACCCTCACCCCAGG + Intronic
929235606 2:39602339-39602361 CTCTCCACACCAATCCCCCCAGG + Intergenic
932414541 2:71565647-71565669 CTGCCCTCTCCACACCCCCCAGG - Intronic
932477175 2:72013538-72013560 CTGCCTTCACCAATAGCCCAGGG - Intergenic
934715174 2:96538859-96538881 CTGCCCGCCCCACTCACCCTGGG - Intronic
935305753 2:101734838-101734860 CTCTCCTCCACAATCACCCCAGG - Intronic
937221243 2:120344365-120344387 GTGCCCTCACCCAGCTCCCCGGG - Intergenic
937951259 2:127389461-127389483 CTTCCCTCACTTACCACCCCGGG + Intergenic
938696516 2:133840216-133840238 CTGCCTTCACCAGTCAGCCTGGG + Intergenic
940359351 2:152781061-152781083 TTGCCCTCAGCAAACACCTCAGG + Intergenic
943809417 2:192165670-192165692 CTTTCCTCTCCAATAACCCCAGG + Intronic
945065001 2:205940929-205940951 CTGCCGTCACAAAACACCACAGG + Intergenic
946911689 2:224468073-224468095 CTGCCCACAAGAATCACCTCAGG + Intergenic
947374793 2:229484615-229484637 CTGACATCACCAATGACACCTGG - Intronic
947744322 2:232499836-232499858 CTGCCCACTCCAACCACCCTAGG - Intergenic
1170857568 20:20071168-20071190 CTGCCCTTTCCTATCCCCCCTGG - Intronic
1171173936 20:23037175-23037197 CTTCCCTCCCCACTCACCCCCGG + Intergenic
1172177178 20:32979571-32979593 CTGCCCTCACCCAAGTCCCCAGG - Intergenic
1173405083 20:42757410-42757432 CTGCCCTAAGCTATCACCACAGG + Intronic
1173979515 20:47212344-47212366 CTGCCATAGCCAATCACCACAGG + Intronic
1175058534 20:56220256-56220278 CTGCCCTCACCAAGCTTACCTGG + Intergenic
1175317369 20:58058490-58058512 CTGCCCCCACCCTTCACACCTGG + Intergenic
1175334354 20:58185404-58185426 CAGGCCTCTCCATTCACCCCTGG + Intergenic
1175856444 20:62123065-62123087 CGCCCCTCACCAAACACCGCCGG - Intronic
1176369971 21:6056751-6056773 CTGCCCCCACCATGCTCCCCTGG + Intergenic
1178707320 21:34886772-34886794 CTGCCCTCGCGGATCTCCCCCGG + Intronic
1179644903 21:42769959-42769981 CTGCCCTCACCCATCGCTGCCGG + Intronic
1179753548 21:43481790-43481812 CTGCCCCCACCATGCTCCCCTGG - Intergenic
1179819638 21:43929377-43929399 CTGCCATCACCACACACTCCTGG + Intronic
1180088950 21:45524131-45524153 CTGCCCTAAGCGTTCACCCCTGG + Intronic
1180089009 21:45524358-45524380 CTGCCCTGAACGTTCACCCCTGG + Intronic
1180089030 21:45524434-45524456 CTGCCCTAAGCGTTCACCCCTGG + Intronic
1180089089 21:45524661-45524683 CTGCCCTGAACGTTCACCCCTGG + Intronic
1180089110 21:45524737-45524759 CTGCCCTAAGCGTTCACCCCTGG + Intronic
1180152762 21:45960173-45960195 CTGCCCTTGCCAAGCATCCCAGG + Intergenic
1180205153 21:46255299-46255321 CTGCTCTCCCCAAACACACCAGG - Intronic
1180764101 22:18233722-18233744 CTGCCCTCAGCACTCAGCCTTGG - Intergenic
1180771542 22:18390819-18390841 CTGCCCTCAGCACTCAGCCTTGG + Intergenic
1180802922 22:18640434-18640456 CTGCCCTCAGCACTCAGCCTTGG + Intergenic
1180829067 22:18888777-18888799 CTGCCCTCAGCACTCAGCCTTGG - Intergenic
1181083749 22:20429886-20429908 CTACCCTCACCCCTCACCCGCGG + Intronic
1181218795 22:21354827-21354849 CTGCCCTCAGCACTCAGCCTTGG - Intergenic
1181495236 22:23283920-23283942 CACCCCCCACCCATCACCCCAGG + Intronic
1181538706 22:23561414-23561436 CTGGCCTCACCCCTAACCCCTGG - Intergenic
1183521665 22:38299227-38299249 CTGCCCTCGCCAAGCACCCTGGG + Intronic
1183623265 22:38986951-38986973 CTGCCCTCAGGAATCATCCCAGG - Intronic
1183630074 22:39027414-39027436 CTGCCCTCAGGAATCATCCCAGG - Intronic
1183633510 22:39047279-39047301 CTGCCCTCAGGAATCATCCCAGG - Intronic
1184438778 22:44496445-44496467 CTGCCCTCTCCAAGCTCCCCTGG - Exonic
1184697635 22:46149102-46149124 CTTCCCTCACCAAACACAACAGG + Intergenic
1185146026 22:49137175-49137197 CAGCCCTCAGCAGTCTCCCCAGG + Intergenic
1203233380 22_KI270731v1_random:131810-131832 CTGCCCTCAGCACTCAGCCTTGG + Intergenic
1203279158 22_KI270734v1_random:114764-114786 CTGCCCTCAGCACTCAGCCTTGG - Intergenic
950124064 3:10500913-10500935 CTGCCCTCACCAAGGACACTGGG + Intronic
950267414 3:11584899-11584921 CTGCCCTCTCCCAGCACCCAGGG + Intronic
950462823 3:13135459-13135481 CTGGCCTCACCCCTGACCCCAGG - Intergenic
953666858 3:44931550-44931572 CTGCCCTCACTGCTCAGCCCTGG - Intronic
953912131 3:46898545-46898567 CTCCCTGCACCCATCACCCCCGG + Intronic
954622773 3:52005358-52005380 CTGCCCTCCCCAATCTCCCCTGG + Intergenic
954847814 3:53575090-53575112 CAGTCCTCTCCAAACACCCCAGG - Intronic
956279364 3:67540342-67540364 CTCCTCCCACCAAGCACCCCAGG - Intronic
958036442 3:88175100-88175122 CTGCACTCCCCAACCAGCCCTGG - Intergenic
959105040 3:102056031-102056053 CTGCCCTCACTCATCACCCAGGG + Intergenic
960011179 3:112835719-112835741 CTGCCCTCAGCAACCCCCCTCGG + Intronic
960653544 3:119978521-119978543 CTGCCCCCAGCACTCATCCCGGG - Intronic
961058901 3:123811830-123811852 CTGGCCTAATCAATCACACCTGG - Intronic
961330644 3:126135966-126135988 CTGCCCTCACCACACCCCACCGG - Intronic
961515281 3:127428508-127428530 CTGCCTCCACCACTCACCACTGG + Intergenic
962394320 3:135001576-135001598 CTTCCCTCACCACTAACCCCAGG + Intronic
963102183 3:141618326-141618348 CTGACCACTCCAATCACCCATGG - Intergenic
965839420 3:172886290-172886312 CTGCCCCCACCAAGCATCCCTGG - Intergenic
966273209 3:178133817-178133839 CTCCTATCACCAATGACCCCTGG - Intergenic
967055521 3:185825696-185825718 CTGCCCTCGCCTCTCACCTCCGG - Intergenic
967574125 3:191070435-191070457 CTGCTCTCTCCAATCACTTCTGG - Intergenic
969720534 4:8891125-8891147 CTGTCCTCCCCACCCACCCCAGG + Intergenic
970448252 4:16141689-16141711 CTGCCTGCTCTAATCACCCCAGG - Intergenic
976412915 4:84737842-84737864 CGGCCCTCAGCAATCACCTGAGG + Intronic
977238044 4:94532565-94532587 CTGCCCTCAGCAATCCTTCCGGG + Intronic
978811011 4:112849900-112849922 CTGCCCTCACCAATATCGGCGGG + Intronic
981162280 4:141512944-141512966 GTGTTCTCAGCAATCACCCCTGG - Intergenic
981192938 4:141884741-141884763 CTGACTTCTCCAATAACCCCAGG + Intergenic
981341796 4:143629806-143629828 CTGGCCTCACCACTCACCTGTGG - Intronic
982126677 4:152189767-152189789 CTGGCTTCCCCACTCACCCCTGG + Intergenic
984565884 4:181329689-181329711 CAACCCTCACCAAGCCCCCCAGG + Intergenic
986393524 5:7306158-7306180 CTGCCCTCACCAGTCACCCCAGG - Intergenic
986393561 5:7306307-7306329 CTGCCCTCACCGGTCACCCCAGG - Intergenic
986524296 5:8656549-8656571 CTGCCCTCATCCTTCACCCATGG - Intergenic
986733013 5:10649159-10649181 CTGCCCCCACCCCCCACCCCTGG - Intronic
990604656 5:57396489-57396511 CCACCCACACCGATCACCCCAGG + Intergenic
990783041 5:59387948-59387970 CAGCCCCCACCCATCAGCCCTGG + Intronic
991019212 5:61962548-61962570 CTGCCCTCACCAATGAAGTCTGG + Intergenic
993110140 5:83646692-83646714 CTTCCCTCACCCCTCACCACAGG - Intronic
995865601 5:116686747-116686769 CGGGCCTCCCCAACCACCCCGGG - Intergenic
996587538 5:125107345-125107367 CTGCCCTCTCCACTCCCCACAGG - Intergenic
998588926 5:143456838-143456860 CAGCCCTCACCTCTCAGCCCTGG + Intergenic
999324925 5:150637990-150638012 TAGCCCTCCCCATTCACCCCTGG + Intronic
1001273535 5:170333487-170333509 CTTCCCACACCCATCACCCCAGG - Intergenic
1001534787 5:172490793-172490815 CAGCCCCCACCACCCACCCCAGG - Intergenic
1001585788 5:172833305-172833327 GAGCCCTCACCATTCTCCCCTGG + Intergenic
1002106209 5:176880564-176880586 CTGCCCTCTCCACCCACCCAGGG + Exonic
1002679798 5:180952324-180952346 CTTCCCTCACCACTAACCTCTGG + Intergenic
1003028335 6:2578685-2578707 CTGCTCTCACCTCTAACCCCAGG + Intergenic
1006294740 6:33165176-33165198 CTGCCCCCAACAGTAACCCCAGG + Intronic
1006316972 6:33297164-33297186 TTGCCCTCAGCCTTCACCCCAGG + Intronic
1006593308 6:35173923-35173945 TGGCCCCCAGCAATCACCCCTGG - Intergenic
1007383283 6:41504130-41504152 CTGCCCTCCGCCCTCACCCCCGG + Intergenic
1007983450 6:46183266-46183288 CTGCCCTCACCAATGAGGGCAGG - Intergenic
1015448737 6:133339655-133339677 CTGCCCTGACCACTTACCACAGG - Intronic
1016712867 6:147193323-147193345 CTCTCCTCACCTCTCACCCCTGG - Intergenic
1017153054 6:151298279-151298301 CTGCACTCAACAATAACACCTGG - Intronic
1017991504 6:159493100-159493122 CTGACATCACCACACACCCCAGG - Intergenic
1018441188 6:163814856-163814878 CTGGCCTCTGCAGTCACCCCAGG - Intergenic
1018666666 6:166144754-166144776 GTGCCCTCATCACTCACACCAGG + Intergenic
1019379647 7:714117-714139 CTGTCCTCACCAGTCTACCCTGG - Intronic
1019540004 7:1547173-1547195 CTGCCCTCCCCCAGCCCCCCCGG - Exonic
1019606151 7:1911226-1911248 CTGTCCTCACCAACCCTCCCTGG + Intronic
1020116295 7:5478283-5478305 CGGCCCTCACCCAGCCCCCCTGG + Intronic
1022452262 7:30525955-30525977 CTGCCCTTGCCAATCTCCCCAGG - Intronic
1022653175 7:32295325-32295347 CTGCCCTGACCCGTCAGCCCGGG - Intronic
1023860816 7:44216811-44216833 CTGACCTCTCCATTCACCCCCGG - Intergenic
1024097508 7:45994980-45995002 ATTCCCTCACCAATCACTCGGGG - Intergenic
1025142752 7:56479293-56479315 CTGCCTTCACCCCACACCCCAGG - Intergenic
1025708806 7:63889893-63889915 CTGCCTTCACCCCACACCCCAGG - Intergenic
1026891636 7:73985956-73985978 CTGACCTCTCCAAGCAACCCCGG - Intergenic
1029289847 7:99493997-99494019 CTGCCCTGACCAAGCACCAGAGG - Exonic
1034266052 7:149781148-149781170 CTGTCATCACCACTCAGCCCAGG + Intergenic
1034745118 7:153517265-153517287 CAGTCCTCAGCAATCAGCCCAGG + Intergenic
1035373965 7:158395521-158395543 CACCCCTCACCCCTCACCCCTGG - Intronic
1035373990 7:158395584-158395606 CACCCCTCACCCCTCACCCCTGG - Intronic
1035941761 8:3909311-3909333 ATGCCCACACGAATCACCCTAGG - Intronic
1036460204 8:8945789-8945811 CTTCCCTCACCCGTAACCCCTGG - Intergenic
1039588455 8:38727109-38727131 CTGCCCCCACCCCGCACCCCAGG - Intergenic
1040370023 8:46760326-46760348 CTGCTCTCACCAATCAAGCTAGG + Intergenic
1042252992 8:66775141-66775163 CCGCCCTCACCAATCACCACCGG - Intronic
1045670980 8:104553114-104553136 CAGCCCTCCCCAAGGACCCCTGG - Intronic
1047504275 8:125466529-125466551 CTGCTCTGGCAAATCACCCCTGG - Intergenic
1048943382 8:139422523-139422545 TTGCCCTCAGCAAGCACCTCAGG - Intergenic
1049297578 8:141851003-141851025 CTGCCATCATCAAGCACCACAGG - Intergenic
1049699739 8:144004855-144004877 GTGCCCACTCCATTCACCCCAGG - Intronic
1050182019 9:2933244-2933266 CTGCCCTGAGAACTCACCCCTGG + Intergenic
1052894514 9:33734803-33734825 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1053011571 9:34636839-34636861 CTGCCCCAACCAATCACCTGTGG + Intronic
1053276246 9:36785791-36785813 CTGTCCTCACTAACCATCCCAGG + Intergenic
1053307281 9:36993868-36993890 CTGCCCTCTCCCATACCCCCAGG + Intronic
1055212482 9:73813399-73813421 CTGCGCTCAGCAAGCAACCCAGG - Intergenic
1055537873 9:77268011-77268033 CTCCCCCCACCAAGCATCCCAGG + Intronic
1057168626 9:92947526-92947548 CTTCCCGCGCCAATCAGCCCAGG - Exonic
1057704843 9:97389023-97389045 GTGGCCTCACCCATCACCCTGGG - Intergenic
1059176867 9:112175607-112175629 CTCCCCTCACCCCTCTCCCCGGG - Intergenic
1061017361 9:127989602-127989624 CTGCCCTGACCACCCACCCCAGG - Intergenic
1061065560 9:128275694-128275716 CCGCCCTCGCCAGTCGCCCCCGG - Intronic
1061243456 9:129387864-129387886 CTGGCCTCACCCCTAACCCCTGG + Intergenic
1062055870 9:134469541-134469563 CACCCCTCACCACCCACCCCAGG + Intergenic
1062067647 9:134537359-134537381 CTGCCCTCCCCAGGCACCCTGGG - Intergenic
1062393762 9:136344329-136344351 CTGCCCTCACAAAGCACCGCAGG + Intronic
1185880348 X:3734674-3734696 CTGCCTTCACCAAGTACCACAGG - Intergenic
1189122344 X:38408106-38408128 CTGCCCTCACCAAACCATCCCGG + Intronic
1190232146 X:48590485-48590507 CTGACCTCACCACCCACCACTGG - Intronic
1190811007 X:53883396-53883418 CCGCCCTCCCCAACCAGCCCTGG + Intergenic
1193404069 X:81081090-81081112 CTGCCCTCAGCACTCCCCCTGGG + Intergenic
1197759997 X:130021198-130021220 CTGCCCTCACCACTGTGCCCTGG - Intronic
1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG + Intronic
1200079251 X:153567441-153567463 CTGTCCTCACCCCCCACCCCAGG - Intronic
1200308836 X:155056833-155056855 CTGCCCTCACCAATAATCACAGG - Exonic
1201943460 Y:19484035-19484057 CTCCCCTCAGCCCTCACCCCAGG - Intergenic
1202374116 Y:24218035-24218057 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1202374163 Y:24218190-24218212 TTGCCCTTGCCAATCACCACAGG - Intergenic
1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG + Intergenic
1202496665 Y:25452085-25452107 CTGCCCTCACCAGTCATCCCTGG + Intergenic