ID: 1123760844

View in Genome Browser
Species Human (GRCh38)
Location 15:23431414-23431436
Sequence TCCTGGAGCAGGGTTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123760844_1123760849 -7 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760849 15:23431430-23431452 TCCAGGAGGGTCCAGTCTTTTGG No data
1123760844_1123760851 2 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760851 15:23431439-23431461 GTCCAGTCTTTTGGTTTCCCTGG 0: 10
1: 116
2: 894
3: 994
4: 751
1123760844_1123760859 30 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760859 15:23431467-23431489 ACTGGAAGAAGAATTGTCTTGGG 0: 130
1: 394
2: 410
3: 264
4: 747
1123760844_1123760858 29 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760858 15:23431466-23431488 CACTGGAAGAAGAATTGTCTTGG 0: 141
1: 382
2: 397
3: 233
4: 394
1123760844_1123760852 3 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760852 15:23431440-23431462 TCCAGTCTTTTGGTTTCCCTGGG 0: 8
1: 132
2: 905
3: 1022
4: 794
1123760844_1123760854 12 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760854 15:23431449-23431471 TTGGTTTCCCTGGGCCACACTGG 0: 23
1: 354
2: 884
3: 838
4: 683

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123760844 Original CRISPR TCCTGGAGCAGGGTTTTCAC AGG (reversed) Intergenic
No off target data available for this crispr