ID: 1123760844

View in Genome Browser
Species Human (GRCh38)
Location 15:23431414-23431436
Sequence TCCTGGAGCAGGGTTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123760844_1123760852 3 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760852 15:23431440-23431462 TCCAGTCTTTTGGTTTCCCTGGG No data
1123760844_1123760858 29 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760858 15:23431466-23431488 CACTGGAAGAAGAATTGTCTTGG No data
1123760844_1123760851 2 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760851 15:23431439-23431461 GTCCAGTCTTTTGGTTTCCCTGG No data
1123760844_1123760854 12 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760854 15:23431449-23431471 TTGGTTTCCCTGGGCCACACTGG No data
1123760844_1123760849 -7 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760849 15:23431430-23431452 TCCAGGAGGGTCCAGTCTTTTGG No data
1123760844_1123760859 30 Left 1123760844 15:23431414-23431436 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123760859 15:23431467-23431489 ACTGGAAGAAGAATTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123760844 Original CRISPR TCCTGGAGCAGGGTTTTCAC AGG (reversed) Intergenic