ID: 1123765303

View in Genome Browser
Species Human (GRCh38)
Location 15:23471909-23471931
Sequence TGGATAGAAGATTCGTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123765303_1123765305 7 Left 1123765303 15:23471909-23471931 CCAAAGAACGAATCTTCTATCCA No data
Right 1123765305 15:23471939-23471961 ATTAAAATCGTCTCCTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123765303 Original CRISPR TGGATAGAAGATTCGTTCTT TGG (reversed) Intergenic
No off target data available for this crispr