ID: 1123765844

View in Genome Browser
Species Human (GRCh38)
Location 15:23477806-23477828
Sequence CTGGGCAACAAAGCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123765844_1123765852 -2 Left 1123765844 15:23477806-23477828 CCTGCAACAGCTTTGTTGCCCAG No data
Right 1123765852 15:23477827-23477849 AGAACATGGGGCTTGAGAAGGGG No data
1123765844_1123765854 4 Left 1123765844 15:23477806-23477828 CCTGCAACAGCTTTGTTGCCCAG No data
Right 1123765854 15:23477833-23477855 TGGGGCTTGAGAAGGGGTGAGGG No data
1123765844_1123765853 3 Left 1123765844 15:23477806-23477828 CCTGCAACAGCTTTGTTGCCCAG No data
Right 1123765853 15:23477832-23477854 ATGGGGCTTGAGAAGGGGTGAGG No data
1123765844_1123765850 -4 Left 1123765844 15:23477806-23477828 CCTGCAACAGCTTTGTTGCCCAG No data
Right 1123765850 15:23477825-23477847 CCAGAACATGGGGCTTGAGAAGG No data
1123765844_1123765856 11 Left 1123765844 15:23477806-23477828 CCTGCAACAGCTTTGTTGCCCAG No data
Right 1123765856 15:23477840-23477862 TGAGAAGGGGTGAGGGAAGTGGG No data
1123765844_1123765855 10 Left 1123765844 15:23477806-23477828 CCTGCAACAGCTTTGTTGCCCAG No data
Right 1123765855 15:23477839-23477861 TTGAGAAGGGGTGAGGGAAGTGG No data
1123765844_1123765851 -3 Left 1123765844 15:23477806-23477828 CCTGCAACAGCTTTGTTGCCCAG No data
Right 1123765851 15:23477826-23477848 CAGAACATGGGGCTTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123765844 Original CRISPR CTGGGCAACAAAGCTGTTGC AGG (reversed) Intergenic
No off target data available for this crispr