ID: 1123771896

View in Genome Browser
Species Human (GRCh38)
Location 15:23537400-23537422
Sequence CACACTGGACAGATGCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123771896_1123771899 4 Left 1123771896 15:23537400-23537422 CCTTGTTGCATCTGTCCAGTGTG No data
Right 1123771899 15:23537427-23537449 AGACTTCCGACTATAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123771896 Original CRISPR CACACTGGACAGATGCAACA AGG (reversed) Intergenic
No off target data available for this crispr