ID: 1123771899

View in Genome Browser
Species Human (GRCh38)
Location 15:23537427-23537449
Sequence AGACTTCCGACTATAAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123771896_1123771899 4 Left 1123771896 15:23537400-23537422 CCTTGTTGCATCTGTCCAGTGTG No data
Right 1123771899 15:23537427-23537449 AGACTTCCGACTATAAACTGTGG No data
1123771895_1123771899 5 Left 1123771895 15:23537399-23537421 CCCTTGTTGCATCTGTCCAGTGT No data
Right 1123771899 15:23537427-23537449 AGACTTCCGACTATAAACTGTGG No data
1123771894_1123771899 9 Left 1123771894 15:23537395-23537417 CCATCCCTTGTTGCATCTGTCCA No data
Right 1123771899 15:23537427-23537449 AGACTTCCGACTATAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123771899 Original CRISPR AGACTTCCGACTATAAACTG TGG Intergenic
No off target data available for this crispr