ID: 1123774159

View in Genome Browser
Species Human (GRCh38)
Location 15:23561773-23561795
Sequence CAGTCACAGGATTCTTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123774151_1123774159 29 Left 1123774151 15:23561721-23561743 CCCCTATAGAAATCTGACTGCTG No data
Right 1123774159 15:23561773-23561795 CAGTCACAGGATTCTTTGGGTGG No data
1123774153_1123774159 27 Left 1123774153 15:23561723-23561745 CCTATAGAAATCTGACTGCTGTG No data
Right 1123774159 15:23561773-23561795 CAGTCACAGGATTCTTTGGGTGG No data
1123774152_1123774159 28 Left 1123774152 15:23561722-23561744 CCCTATAGAAATCTGACTGCTGT No data
Right 1123774159 15:23561773-23561795 CAGTCACAGGATTCTTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123774159 Original CRISPR CAGTCACAGGATTCTTTGGG TGG Intergenic
No off target data available for this crispr