ID: 1123775556

View in Genome Browser
Species Human (GRCh38)
Location 15:23575630-23575652
Sequence CTCACTCATCTCTGCAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123775556_1123775558 24 Left 1123775556 15:23575630-23575652 CCATTCTTGCAGAGATGAGTGAG 0: 1
1: 0
2: 7
3: 65
4: 300
Right 1123775558 15:23575677-23575699 AACTGGTTGTTAAAAGACCTTGG 0: 1
1: 1
2: 6
3: 45
4: 268
1123775556_1123775557 7 Left 1123775556 15:23575630-23575652 CCATTCTTGCAGAGATGAGTGAG 0: 1
1: 0
2: 7
3: 65
4: 300
Right 1123775557 15:23575660-23575682 TCTTGAGTTCTCTAGAGAACTGG 0: 1
1: 0
2: 2
3: 18
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123775556 Original CRISPR CTCACTCATCTCTGCAAGAA TGG (reversed) Intronic
901640261 1:10689479-10689501 TTCACTCTCCTCTCCAAGAAAGG - Intronic
902594428 1:17498778-17498800 CTACCTCACCCCTGCAAGAATGG - Intergenic
903521420 1:23953510-23953532 CTCGTTCACCTCTGCAACAAAGG - Intergenic
903692215 1:25182646-25182668 CTCACTGATATCTGCAGGAGAGG + Intergenic
905536987 1:38729897-38729919 CTCCCTAGTCTCTGCAAGATTGG + Intergenic
906179807 1:43808527-43808549 GGCACTGATCTCTGAAAGAAGGG + Intronic
906567142 1:46809232-46809254 CTCACTCAATCCTGCCAGAATGG + Intronic
907614804 1:55912963-55912985 CTCCCTCATGTCTGCAGGACTGG - Intergenic
907840508 1:58152545-58152567 CTCAGTCTTCTCTGCAAAATGGG + Intronic
907860815 1:58351390-58351412 CTCACTCCCATCTGCAAGAAGGG + Intronic
908741217 1:67329651-67329673 GTCCCTCATCTCTCCAATAAAGG - Exonic
909418031 1:75429780-75429802 CTCACTCATTACTGCAAGGATGG + Intronic
909455864 1:75847806-75847828 CTCACTCATCACGGTAGGAATGG + Intronic
909492379 1:76239619-76239641 CTCACTCATTACTGCAAGGGAGG + Intronic
910482453 1:87673598-87673620 CTCACTTATCTTTGAAATAAAGG - Intergenic
911062847 1:93762720-93762742 CTCCCTCTTCTCTGCAAAGATGG + Intronic
911709168 1:101049652-101049674 CTCACTGATCTCTGAAATATGGG - Intergenic
914413429 1:147454947-147454969 CTCACTCATTACTGCAAGGATGG + Intergenic
915238075 1:154500645-154500667 CCAACTCATCTCAGCAAGAATGG + Intronic
917666289 1:177228939-177228961 CTCATTCATTCCTTCAAGAATGG + Intronic
918345546 1:183604369-183604391 CTGACTCAGCTCTTCAAGGAGGG + Intergenic
918605911 1:186425546-186425568 CATACTCATCTCTTCAAGACAGG + Intergenic
919315334 1:195965707-195965729 CTCACTCATATCAGTAGGAAGGG - Intergenic
920626233 1:207603554-207603576 CTTACTCATCTTTTCAGGAAAGG - Intronic
921040086 1:211422733-211422755 CTCACTCATTACTGAGAGAATGG + Intergenic
924400778 1:243678402-243678424 TTCACTGATCTCTAGAAGAATGG + Intronic
1063766642 10:9149190-9149212 CTCACTGGTCTCTACAAGGAAGG + Intergenic
1065256515 10:23875084-23875106 CTCACTCATTACTGCAAGGAGGG + Intronic
1066006985 10:31154620-31154642 TTCACTCACTCCTGCAAGAATGG + Intergenic
1067224129 10:44364286-44364308 TCCACTCATCTCTGCAATGAAGG - Intergenic
1067412595 10:46078035-46078057 CTCACTCATTACTGCAGGGAAGG - Intergenic
1067746630 10:48941153-48941175 CGCATTCATCTCTGCAACCACGG - Intronic
1072069463 10:91902654-91902676 ATCACACCTCTCTGCAAGAAAGG + Intergenic
1072233038 10:93429122-93429144 CTCACTCATTACTGCAAGAATGG - Intronic
1072558781 10:96548982-96549004 CTTATTCATCTCTCCAAGATGGG + Intronic
1074553128 10:114463716-114463738 CTCAGTTATCTCAGGAAGAATGG + Intronic
1075625525 10:123961777-123961799 CTCACTCATGTCTGGAACAAAGG + Intergenic
1076488670 10:130840870-130840892 CTATCTCATTCCTGCAAGAATGG + Intergenic
1077751198 11:4971922-4971944 CTCACTCAATCCTGCAAGAATGG + Intronic
1078195491 11:9133605-9133627 CTCAGTCATCTCTGCCATGATGG - Intronic
1079497855 11:21066548-21066570 CTCACTAATCTGTGAAATAAAGG + Intronic
1082206600 11:49442911-49442933 CCCACTCTGCTCTGAAAGAATGG + Intergenic
1082689106 11:56278054-56278076 CTCTCTCATCTCTGCACACAAGG + Intergenic
1083861616 11:65423086-65423108 CTCGCTCAGCTATGCAAGAGCGG - Intergenic
1085518826 11:77126513-77126535 CTCCCTGATCTGTGCATGAAGGG + Intergenic
1086580931 11:88397501-88397523 CTCACTCATTACTGCAAAAAGGG - Intergenic
1086820881 11:91434382-91434404 CTCACTCATTTCTGTGAGTATGG + Intergenic
1087082028 11:94180204-94180226 CTCTCTCATCTCTGCAGACATGG - Exonic
1089388246 11:118081940-118081962 CTCACTGATGTCCACAAGAAGGG + Intronic
1090018326 11:123105241-123105263 CCTGCTCATCTCTGCTAGAAGGG + Intronic
1090334384 11:125953097-125953119 CTTACTAGTCTCTGCATGAACGG - Intergenic
1090915259 11:131157321-131157343 CCCACTTATCACTGCAAGGATGG - Intergenic
1093541235 12:20287845-20287867 CTCACTCATTACTGCAAGAAGGG + Intergenic
1094282245 12:28753173-28753195 CTCACTCATTACTGCTAAAAGGG - Intergenic
1094437068 12:30432383-30432405 TGCTCTCATCTCTGCAAGAATGG + Intergenic
1095332495 12:40984572-40984594 CTCACTCATTATTGGAAGAAAGG + Intronic
1095344546 12:41134227-41134249 TTTACTCATCTCTGCAATAAAGG + Intergenic
1095883339 12:47162723-47162745 CGCACTCATTACTGCAAGGATGG + Intronic
1096383621 12:51179860-51179882 TTCACTCACCCCTACAAGAAAGG + Intergenic
1097041726 12:56159963-56159985 CACATTCATCTCTGCCATAAAGG - Exonic
1097615349 12:61878928-61878950 CTCCCTCATCTCTGCAAGAGGGG - Intronic
1100051559 12:90455382-90455404 ATCACTCATCTCTGTTAGGATGG - Intergenic
1101163571 12:102005258-102005280 CTCACTTATCCCAGCAAAAAGGG - Intronic
1101382238 12:104224145-104224167 CTCACTCATCTGTTCATGAATGG + Intronic
1102835778 12:116058636-116058658 GCAACTTATCTCTGCAAGAAAGG - Intronic
1106075580 13:26458136-26458158 CGCAGTCATCTGTGCAAGAAAGG + Intergenic
1106559799 13:30838405-30838427 CTCACTCATTACTACAAGGAGGG + Intergenic
1109901937 13:68784932-68784954 CTCACTCATGACCACAAGAATGG - Intergenic
1109906135 13:68844868-68844890 CTCACTCACTTTTACAAGAAAGG - Intergenic
1112223420 13:97514242-97514264 CTCACTCATTACTGCAAGGAGGG + Intergenic
1112769901 13:102783614-102783636 CTCACTTGTCACTGCAAGGATGG + Intergenic
1114412407 14:22513405-22513427 CTCACTTATCCCTGGAACAAGGG - Intergenic
1114431826 14:22667986-22668008 CTCACTTATTACTGCAAGGACGG + Intergenic
1116261636 14:42635820-42635842 CACAATCATCTCTGGCAGAAGGG + Intergenic
1116350225 14:43852135-43852157 GTCACTCAATTCTGAAAGAATGG - Intergenic
1117212878 14:53519624-53519646 CTCACTCATTACTGCAAGGATGG + Intergenic
1117792111 14:59351973-59351995 CTCACCCAGCTCTGCATGGAAGG + Intronic
1119126680 14:72133799-72133821 TCCACTCATCTCTTCAAGCAGGG + Intronic
1119782472 14:77286019-77286041 TTCACTCATCTAAGCCAGAAAGG + Intronic
1120263000 14:82212289-82212311 CTCACTGACTTCTGAAAGAATGG - Intergenic
1120721597 14:87895000-87895022 CCCACTCATGGCAGCAAGAAAGG + Intronic
1120793479 14:88607234-88607256 TTCACTCATCTCAGCTACAAAGG - Exonic
1121211198 14:92209128-92209150 CTCCCTCATCTCTGTAGGTACGG + Intergenic
1121288658 14:92756719-92756741 CTCACTCACTCCTGCAATAATGG + Intergenic
1121888128 14:97563259-97563281 CTCACTCATTACTGCAAAAATGG - Intergenic
1122429042 14:101628497-101628519 CGCACTCATTTCTGCAAAGAAGG - Intergenic
1123163346 14:106301593-106301615 CTCACTCAGCAATGCTAGAATGG - Intergenic
1123775556 15:23575630-23575652 CTCACTCATCTCTGCAAGAATGG - Intronic
1124434778 15:29638099-29638121 CTCAGTCCTTTCTGCAAGGAAGG + Intergenic
1124661165 15:31552045-31552067 CTCACTCATTACTGCGAGGATGG - Intronic
1126204945 15:46034979-46035001 CTCACTCACTACTGCCAGAAGGG - Intergenic
1127186675 15:56487668-56487690 CTCACTCATCACAGCTAAAATGG - Intergenic
1130173363 15:81540970-81540992 TTCACTCATTACTACAAGAATGG - Intergenic
1131362489 15:91805650-91805672 CTTACTTATCCCTGAAAGAAGGG - Intergenic
1132993206 16:2808102-2808124 CTCACTCATTACTGCAGGGAGGG + Intergenic
1132993371 16:2809203-2809225 CTCCCTCATTTCTGAAAGATAGG + Intergenic
1133079088 16:3304520-3304542 CTTACTCAACTCTGCAATATTGG + Intronic
1134874856 16:17688900-17688922 CTCACTCATTACTGCAAGGATGG + Intergenic
1135263619 16:21002395-21002417 CTCAGTTATCTCAGCAAAAAAGG - Intronic
1135653518 16:24227629-24227651 CTCTCTCATCTCCACAAGGATGG - Intergenic
1136683727 16:31982275-31982297 CTCACTTCCCTCTGCTAGAAAGG + Intergenic
1136784356 16:32925831-32925853 CTCACTTCCCTCTGCTAGAAAGG + Intergenic
1136885429 16:33927975-33927997 CTCACTTCCCTCTGCTAGAAAGG - Intergenic
1138098851 16:54235467-54235489 CTCACACATCCCTGGAAGGAGGG + Intergenic
1139778410 16:69331065-69331087 CCCACTCAGCTCTCCAAGTACGG - Exonic
1141978554 16:87534741-87534763 CTCACTCATTACTGCATGGACGG - Intergenic
1142331019 16:89453933-89453955 CTGACTTATCTCTGCCACAAGGG + Intronic
1203087013 16_KI270728v1_random:1189837-1189859 CTCACTTCCCTCTGCTAGAAAGG + Intergenic
1143725444 17:8841952-8841974 CTCACTCATTACCGCAAGGATGG - Intronic
1143837675 17:9704792-9704814 CACACTCGCCTCTGCAAGGAAGG - Intronic
1145023831 17:19452929-19452951 CTCACTCATCAGTTCAGGAAGGG - Intergenic
1145096544 17:20033678-20033700 CTCACTCATTCCTGCAAGAATGG + Intronic
1147144644 17:38477982-38478004 CTCACTTCCCTCTGCTAGAAAGG + Intronic
1147369790 17:39984471-39984493 CTCACTCACCTCTTCCAGGAAGG - Exonic
1148160292 17:45445919-45445941 CTCCCTCATCTCAGCATGATTGG - Intronic
1150391584 17:64792798-64792820 CTCCCTCATCTCAGCATGATTGG - Intergenic
1151242872 17:72771914-72771936 CTCCCTCTTCTCTCCAAGAGGGG + Intronic
1151632949 17:75323521-75323543 CACACACACCTCTGCAAAAAAGG - Intronic
1151731013 17:75911088-75911110 CTCACACAGCCCTGCAAGGAAGG - Intronic
1153803850 18:8694932-8694954 CTCACTCATCACTGAGGGAATGG - Intergenic
1155326243 18:24667707-24667729 CTCACTCATTCCTGCGAGAATGG + Intergenic
1155420076 18:25646340-25646362 TTCACTCACAACTGCAAGAATGG - Intergenic
1155442370 18:25875689-25875711 CTCACTCATTACTGCGAGTATGG - Intergenic
1156201257 18:34834731-34834753 CTCACTCATTGCTGTGAGAATGG + Intronic
1156312197 18:35935065-35935087 CTCCCTCATTACTGCAAGGATGG + Intergenic
1157768091 18:50317955-50317977 CTCACTCACTCCTGCAAGAAAGG - Intergenic
1157978664 18:52355122-52355144 CTCACTCAAGTCTTCAGGAATGG - Intronic
1158417038 18:57257558-57257580 CTCACTCATTACTGCAAGGATGG - Intergenic
1159431400 18:68357551-68357573 CTCTCTCCTCTCTTCATGAATGG + Intergenic
1160020190 18:75174418-75174440 TTCACTCATCTCAAGAAGAAAGG - Intergenic
1160632617 18:80257359-80257381 CTCTCTCATCTCTGCACACAGGG - Intergenic
1163062173 19:14768649-14768671 TTCACTCAACTCTCCAAGTATGG + Intronic
1163885133 19:19958727-19958749 CTCTCTCATCTCTGCACACAGGG - Intergenic
1164411519 19:28009801-28009823 CTGACTCAGCTCTGCAGGAACGG + Intergenic
1164516503 19:28940983-28941005 CTGACTCAGCTCTGCAGGAACGG + Intergenic
1164710880 19:30356403-30356425 CTCACTCATCTGTACCAGGACGG - Intronic
1165060620 19:33203659-33203681 GTCACTCAGCTCTGCCAGGAAGG + Intronic
1165174704 19:33919705-33919727 CTCACTCATTACTGCAAGCATGG - Intergenic
1166350870 19:42197509-42197531 GGCACCCATCCCTGCAAGAAAGG + Intergenic
1167623961 19:50574627-50574649 CTCATTCATTGCTGCAGGAATGG - Intergenic
1168564539 19:57412121-57412143 CTGGCTCATATCTGCAAAAACGG + Intronic
925278859 2:2669260-2669282 CTGACTCCTCGCTGCATGAAGGG - Intergenic
925740741 2:7004041-7004063 CTTTCTCATCTCTGAAAGAAAGG + Intronic
927113935 2:19883879-19883901 CTCACTCAGCTCTGGAGGAAAGG - Intergenic
928613674 2:33015905-33015927 CTCACTCACTATTGCAAGAACGG + Intronic
929342424 2:40837244-40837266 CTCCCTCTTCTCTGCTGGAAAGG - Intergenic
929709896 2:44256163-44256185 CTCATTCATTACTGCAAGAAAGG + Intergenic
929710109 2:44258013-44258035 CTCATTCATTACTGCAAGAAAGG - Intergenic
930254306 2:49071876-49071898 TTCACTCATTACTGCAAGGATGG + Intronic
930613898 2:53573561-53573583 CTGACTTATCTGTGGAAGAAAGG - Intronic
930638979 2:53836015-53836037 CTCACTCATTACTGCCAGGATGG - Intergenic
931398095 2:61905827-61905849 CCCCCTCATCTTTGCCAGAAAGG - Exonic
932313053 2:70759554-70759576 CTCACTCACTACTGCAAGAATGG - Intronic
932916057 2:75859417-75859439 CTCACTCATCACTGCAGGGAGGG + Intergenic
933765070 2:85701653-85701675 CTCACTCATTACCACAAGAATGG - Intergenic
934112561 2:88756819-88756841 CTCCCCCATCTCAGCCAGAATGG - Intergenic
936163770 2:110103280-110103302 CTCCCCCATCTCAGCCAGAATGG - Intronic
937888940 2:126921047-126921069 CCCACTCATAATTGCAAGAATGG + Intergenic
938218735 2:129546734-129546756 CTCACTCATTACTGCAGGGAGGG + Intergenic
940291508 2:152081811-152081833 CTACCTCATCTTTGCAATAAAGG + Intronic
940487509 2:154314729-154314751 CTCAGTCATTACTGCAAGGATGG + Intronic
940496761 2:154439257-154439279 CTCCCTCTTCTCTGTCAGAAAGG - Intronic
940787211 2:157994370-157994392 CTCACTCAATCCCGCAAGAATGG + Intronic
941492341 2:166157914-166157936 CTCACTCATTACTGCAAGGATGG - Intergenic
942388115 2:175463185-175463207 GTCACTTATCTCTGAAATAATGG + Intergenic
943104952 2:183533292-183533314 CTCACTCATTGATGCAAGCAGGG + Intergenic
943152087 2:184126548-184126570 TTCACTCATTCCTGCAAGAATGG + Intergenic
943769558 2:191701796-191701818 CTCACTCATTTCCACAAGGACGG - Intergenic
943857852 2:192821505-192821527 CTCACTCATTACTGTGAGAATGG - Intergenic
944038253 2:195324037-195324059 CTCACTCACTACTGCAAGAATGG - Intergenic
944270659 2:197782414-197782436 GTCACTCATATCAGCCAGAATGG - Intronic
947618214 2:231572078-231572100 CCCACTCATCTCTAAAACAAAGG - Intergenic
947938235 2:234025738-234025760 TTCACTCATCTCTGAAAAAAAGG - Intergenic
1168734676 20:121709-121731 CACACTCAGTTCTCCAAGAAAGG - Intergenic
1169397018 20:5241394-5241416 CCAAGTCATCTCTGAAAGAAAGG - Intergenic
1169511671 20:6270994-6271016 CTCTCTCACCTCCGCAAGCAAGG - Intergenic
1170340293 20:15319429-15319451 CTTTCTCATTTCTGCAAAAAAGG - Intronic
1170685081 20:18562521-18562543 CTCACTCATTTCTGTGAGGATGG - Intergenic
1172182876 20:33014278-33014300 TTCCCTCATCTCTGCTAGGAGGG - Intronic
1173620615 20:44433169-44433191 ATCACTCCCCTCTTCAAGAAGGG - Intergenic
1173965325 20:47108246-47108268 CTCACTCACTCCTGCAAGAATGG - Intronic
1174158223 20:48531095-48531117 ACCACACATCGCTGCAAGAAAGG - Intergenic
1177571472 21:22892543-22892565 CTCTCTCATCTCAGCAGGAATGG + Intergenic
1178110678 21:29367052-29367074 CTCACTCATCCCCACAAGAATGG - Intronic
1178293924 21:31392737-31392759 CTCACTCATGACTGCAAGGATGG - Intronic
1178904146 21:36622742-36622764 CTCTCCCTGCTCTGCAAGAATGG + Intergenic
1181897489 22:26123340-26123362 TTCACTCACTACTGCAAGAATGG - Intergenic
1183038647 22:35159688-35159710 CCAGCTCATCTCTGTAAGAATGG + Intergenic
1184432933 22:44452116-44452138 CTCACTCATTACTGCGAGGAAGG - Intergenic
1185308940 22:50142163-50142185 ATCGCTCATCTCTGCAGTAAAGG - Exonic
949153765 3:803144-803166 CTCACTCATTACTGTAGGAAGGG + Intergenic
949169427 3:980859-980881 CCCACTCATTACTGCAAGGATGG + Intergenic
949597763 3:5565739-5565761 TTCTCTCATCTCTGCAATGAGGG - Intergenic
949837689 3:8286991-8287013 CTCACTCACTCCTGCTAGAAGGG + Intergenic
950115437 3:10447689-10447711 CTCACTTATCCCTGGCAGAATGG - Intronic
950117602 3:10461623-10461645 CTCATTCATCTCTGCAGGGTGGG - Intronic
951989483 3:28660589-28660611 ATCATTCATGTCTGTAAGAATGG + Intergenic
952219408 3:31309631-31309653 CTCACTCCTCCCTCCAAAAAAGG - Intergenic
952360015 3:32621202-32621224 CTAACTCATCTCTCCAGGAGAGG - Intergenic
952615919 3:35273913-35273935 CCCGCTCATCTGTGCATGAATGG - Intergenic
953007305 3:38990287-38990309 CTCACTCACCTCTGCAATAAGGG + Intergenic
955595897 3:60590175-60590197 CTTGCTCAAGTCTGCAAGAAGGG + Intronic
956191062 3:66609080-66609102 CTCACTCACTTCTGCAATAATGG + Intergenic
956284121 3:67590479-67590501 CTCACTCACGTCTGCAAGGAGGG - Intronic
958483375 3:94673974-94673996 CTTATTAATCTCTGCAAGGAGGG + Intergenic
960477953 3:118153872-118153894 CTCACTCATTATTGCAAGGAGGG + Intergenic
962030534 3:131595693-131595715 CTCACTCATTACAGCAAGAAGGG + Intronic
963217855 3:142771083-142771105 CTCACTTATTACTGCAAGGATGG + Intronic
963538486 3:146557870-146557892 TTCACTCATTACTGCAAGGATGG - Intergenic
965485173 3:169270127-169270149 CTCACTGATCCCGGTAAGAAAGG + Intronic
966634025 3:182112241-182112263 CTTACTCATCTTTGAATGAATGG + Intergenic
967377644 3:188823156-188823178 TTCACCCATCTCTTCTAGAAAGG - Intronic
967759733 3:193210070-193210092 CTCACTGGTCTATGCAAGGATGG - Intergenic
969931933 4:10639192-10639214 CTTACTCAGCAGTGCAAGAAAGG - Intronic
969984161 4:11189859-11189881 CTCACTCATCTCTTCATTAATGG + Intergenic
970062367 4:12049627-12049649 CTCACTTATTACTGCAAGGATGG - Intergenic
970162252 4:13200760-13200782 CTTACTCATCTGTGGATGAAAGG - Intergenic
970275135 4:14391614-14391636 CTCACTCAGCTCTGTAATATAGG + Intergenic
970284079 4:14490007-14490029 CCACCTCATTTCTGCAAGAATGG + Intergenic
970686399 4:18572658-18572680 CTCCCTGATATCTGCATGAATGG - Intergenic
971115268 4:23638974-23638996 CTTACTCACTCCTGCAAGAATGG - Intergenic
971537049 4:27766325-27766347 GTGACACATCTCTGCAAAAAAGG + Intergenic
974142550 4:57905727-57905749 CACACTCATCTCTGAAAAGATGG + Intergenic
974204566 4:58684128-58684150 CTCACTCCTCTCTTCAAACAAGG + Intergenic
974680436 4:65154418-65154440 CTGAATAAACTCTGCAAGAAAGG + Intergenic
974743941 4:66045196-66045218 CTCACTCATTACTGCCAGAAAGG + Intergenic
975271668 4:72442524-72442546 CTCACTCATTACTGCTACAATGG + Intronic
975315683 4:72950491-72950513 CCACCTCATCCCTGCAAGAATGG - Intergenic
975351338 4:73350727-73350749 CTTACTCATTACTTCAAGAATGG + Intergenic
976528564 4:86122174-86122196 CTCATTCCTCTCTGCAAACAGGG - Intronic
978264654 4:106809211-106809233 CTCATCCATCTCTGCCAGTATGG + Intergenic
978560948 4:110032754-110032776 CTCACTCATGTATCCAAGACAGG - Intergenic
979103479 4:116653587-116653609 CTCAATCACCTTTCCAAGAAGGG - Intergenic
980309714 4:131110691-131110713 CTGACTCAAATCTGCAAAAACGG - Intergenic
981130191 4:141149922-141149944 CTGACTCACTCCTGCAAGAATGG - Intronic
981586329 4:146307101-146307123 TTCACTGATTTCTGCATGAATGG + Intronic
981918470 4:150060610-150060632 CTCACTCATTCCTGTAATAAGGG + Intergenic
983011359 4:162551180-162551202 CTCACTCGTCTCTGCACACAGGG + Intergenic
983832531 4:172346012-172346034 TTCTCTCATCTCTGCACAAAGGG - Intronic
984400263 4:179255117-179255139 CTCAATCAAATCTGAAAGAATGG + Intergenic
985181401 4:187268162-187268184 CTCACTCATTACTGCAGGGAAGG - Intergenic
987210924 5:15682333-15682355 CTAACACATCACTGCAAGAGAGG + Intronic
987357916 5:17081321-17081343 CTCGCTCCCCTCTGTAAGAAAGG - Intronic
987566260 5:19591001-19591023 CTCACTCATCTTTTCCTGAATGG - Intronic
988250464 5:28750870-28750892 CTCACTCATTCCTGTGAGAATGG - Intergenic
988671561 5:33387216-33387238 CTCACTCATTACTGTGAGAAGGG + Intergenic
989389691 5:40887001-40887023 CTCACTTATTACTACAAGAAGGG - Intergenic
990002676 5:50912808-50912830 CTCACTCATAACCGCAAGGAGGG - Intergenic
995007406 5:107216718-107216740 CTCACTCATCACTGTAAGGATGG - Intergenic
995668275 5:114569358-114569380 CTCCCTCACGACTGCAAGAATGG - Intergenic
996042271 5:118828534-118828556 CGCACTCATCTCTTTAAGAGAGG + Intergenic
997399677 5:133592657-133592679 CTCACTCATTGCTGCAAGGATGG - Intronic
999323989 5:150631777-150631799 CTCCCCCATCTCTTCAAGGAGGG + Intronic
1000262269 5:159599471-159599493 CTCACTTATTACTGCAAGGAGGG + Intergenic
1000295312 5:159908449-159908471 CTCACTCACTCCTGCAAGAATGG - Intergenic
1000424963 5:161079816-161079838 CTCACTCATTACTGCAGGGACGG - Intergenic
1000601543 5:163281349-163281371 CTTGCTCATTACTGCAAGAATGG - Intergenic
1001474324 5:172039198-172039220 CTAACTCACTTCTGCAATAATGG + Intergenic
1001942721 5:175751943-175751965 CTCAATTATCTCAGCAAAAAGGG - Intergenic
1004341967 6:14815771-14815793 ATCTCTCATCTATACAAGAAAGG - Intergenic
1004449172 6:15728858-15728880 CTCACTGAGCTCTGCAGGAGAGG - Intergenic
1004476995 6:15982410-15982432 CTCACGCATTGCTGCAAGAACGG - Intergenic
1004703904 6:18104918-18104940 CTCACTCATTACTGTGAGAATGG + Intergenic
1005256138 6:24005327-24005349 CTCACTCATTACCGCAAGGATGG + Intergenic
1006223032 6:32510815-32510837 CTCACTCATTTCAGCTAGGATGG - Intergenic
1006363821 6:33603026-33603048 CTCACTTATCACTGCTAGGAGGG + Intergenic
1007230813 6:40346470-40346492 CTCACTCATTACCACAAGAAGGG - Intergenic
1007384301 6:41510346-41510368 CCCACCCATCTCTGTAGGAAGGG + Intergenic
1007599534 6:43073205-43073227 CTCACTCCTTTCTGCCAGGATGG + Exonic
1007914928 6:45552564-45552586 TTCACTCCTCTCTGCAACATGGG + Intronic
1008747213 6:54686677-54686699 CTCACTCATTGCTGCAAGTATGG - Intergenic
1009244493 6:61219320-61219342 GTCACTAATCTCTGAGAGAAGGG + Intergenic
1009591552 6:65678202-65678224 CTCACTCATTATTGCAATAATGG + Intronic
1010810862 6:80297745-80297767 GATACTCATCTCTGCAAGTATGG - Intronic
1011220841 6:85053000-85053022 CTCACTCATTACTGTAAGGATGG + Intergenic
1012029048 6:94035712-94035734 CTAACTCATCACTTTAAGAAGGG - Intergenic
1012500455 6:99882385-99882407 CTCACTCATTATTGCAAGGATGG - Intergenic
1012856976 6:104513596-104513618 CTCACTCATTACTGCAAGGAAGG - Intergenic
1013351269 6:109308094-109308116 CTCAGTTCTCTCTGCAACAATGG - Intergenic
1013431004 6:110054789-110054811 CACCCTCCTCTCTGAAAGAATGG - Intergenic
1013503978 6:110780819-110780841 CTTTCTCATCTCTGGAAGATGGG - Intronic
1015190314 6:130465087-130465109 CTCACTCATCACTGCAGGGAGGG + Intergenic
1015222618 6:130822031-130822053 CTAACTCACTCCTGCAAGAATGG + Intergenic
1016483467 6:144507939-144507961 CTGTCTGATCTCTGAAAGAAGGG - Intronic
1016563224 6:145420906-145420928 CTAACTCATTTCTACAATAATGG + Intergenic
1017231164 6:152075535-152075557 CCCACTCATCTCTCAAAGAGAGG + Intronic
1017883009 6:158574585-158574607 ATTTCTCATTTCTGCAAGAATGG - Intronic
1018515029 6:164570134-164570156 CTCACTCATTATTGCAAGGAGGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020746736 7:12088945-12088967 CTCACTCATCCCTCACAGAAGGG - Intergenic
1021841480 7:24724866-24724888 CTCACTCATTACTGCAAGGCGGG - Intronic
1023761983 7:43473071-43473093 CTCACTCATTGCTGCAAGGATGG - Intronic
1023790448 7:43749693-43749715 CCCACTCCACTCTGCAAGACTGG + Intergenic
1025776386 7:64564327-64564349 CTGTCTGATCTCTGGAAGAAAGG - Intergenic
1025857441 7:65294657-65294679 CTAACTTACTTCTGCAAGAATGG - Intergenic
1025864932 7:65372627-65372649 CTGTCTGATCTCTGGAAGAAAGG + Intergenic
1026469468 7:70682617-70682639 CTCAATCAACACTGCGAGAATGG - Intronic
1026655194 7:72250633-72250655 CTCACTCATTACTGCAGGGAGGG - Intronic
1026864766 7:73816788-73816810 CTCGCTCCCTTCTGCAAGAATGG + Intronic
1028334238 7:89631171-89631193 CGCACTCATTACTGCAAGGATGG - Intergenic
1028482246 7:91320389-91320411 CTTACTCAGCTCTTTAAGAAGGG - Intergenic
1029131004 7:98330881-98330903 CTCACTTATTACTGCAAGGAGGG + Intronic
1029373375 7:100163424-100163446 CTCAATCGGCTCTGCAAGTATGG + Intronic
1029925235 7:104308799-104308821 CTCATTCCTCACTGCAAGAATGG - Intergenic
1030382755 7:108831481-108831503 CTCACTCTTCAGTGAAAGAAAGG - Intergenic
1030493280 7:110265649-110265671 CTCATTAATCTCTCCAGGAAAGG - Intergenic
1031550219 7:123101456-123101478 CTCACTCATTACTGCAGGGAGGG + Intergenic
1032010846 7:128346830-128346852 CTCACTCCTCTCTCAAACAAGGG - Intergenic
1032348731 7:131140473-131140495 CTCACTCATCACAGCAAGAAAGG - Intronic
1032392638 7:131566012-131566034 CTCACTCATTTTTGCAAGGACGG + Intergenic
1032928740 7:136640311-136640333 CTCACTCATTACTGCCAGGATGG + Intergenic
1033193892 7:139310081-139310103 CTGTCTCATCACTGGAAGAAGGG + Intergenic
1033280170 7:140000948-140000970 TTCACTCTACTCTGCAAGATGGG + Intronic
1034082666 7:148294214-148294236 GGCACCCATCTCTGCAAGAAAGG + Intronic
1035390156 7:158498218-158498240 CTCACTCCACCCTGGAAGAAGGG + Intronic
1035722879 8:1805337-1805359 CTCACTCACCTGTACAAGGAAGG + Intergenic
1036975610 8:13407789-13407811 CTCACTCACCCGTGAAAGAAAGG + Intronic
1038529256 8:28304346-28304368 CATACTCATCTTTTCAAGAAAGG - Intergenic
1040628851 8:49184942-49184964 CTCACTCATCACTGTGAGGAGGG - Intergenic
1041089010 8:54284559-54284581 CTCACTCATCTCTCCTAGGCTGG + Intergenic
1042490227 8:69389380-69389402 CTCACTCATTACTGCAAGGATGG + Intergenic
1042591221 8:70401734-70401756 TTCACTCAGCTATGCCAGAATGG - Intronic
1043770277 8:84189923-84189945 ATCACACATCTCTTCAAGACGGG + Intronic
1044580389 8:93820269-93820291 CTCACTCATCACTACATAAAAGG + Intergenic
1046229876 8:111340057-111340079 CTCACTCAATGCTGCAAGGATGG - Intergenic
1046565201 8:115890704-115890726 CTAACTCGTCTCTGAAAGAATGG + Intergenic
1047407536 8:124597869-124597891 CTCAGGCATCTCTGCAGGAGAGG + Intronic
1049001464 8:139827978-139828000 CTCACTCATCACTGAGGGAAAGG + Intronic
1050115932 9:2263437-2263459 CCCTCTCATCTGTGAAAGAAGGG + Intergenic
1050657498 9:7845094-7845116 CTCACTCATTACTGCAGGGAGGG + Intronic
1050778859 9:9304870-9304892 CTCAATAATCTCTCCATGAAAGG + Intronic
1052069089 9:24059193-24059215 CTCACTCACTACTGCTAGAATGG + Intergenic
1053234688 9:36442385-36442407 CCCACTCATTTCTGGAAAAAGGG + Intronic
1055376996 9:75659350-75659372 CTCGCTCATTACTGCAAGGAGGG - Intergenic
1056670582 9:88624589-88624611 CTTACTCATTACTGCAAGGAGGG + Intergenic
1056889424 9:90477178-90477200 CTCACTTATTTCTGAAATAATGG + Intergenic
1057088913 9:92238369-92238391 CTCACTCATTACTGCAACAAGGG - Intronic
1057348908 9:94278036-94278058 CTCATTCATTTGTGCAAGACAGG + Intronic
1058422583 9:104846707-104846729 CTCATTCATCTCTTCTGGAACGG + Intronic
1060418688 9:123451864-123451886 CTGAGTCATCTCTGCAATAGAGG + Intronic
1060572564 9:124656064-124656086 CTCACTGACTACTGCAAGAATGG - Intronic
1061324955 9:129858099-129858121 CACACTCACCTGTGCATGAATGG - Exonic
1062251665 9:135600202-135600224 TTCACTCATTACTGCAAGGAGGG + Intergenic
1185596614 X:1310893-1310915 CTCACTCATTACTACAAGAAAGG - Intergenic
1185810507 X:3104839-3104861 CTCACTCATCTCTATAAGAAAGG + Intronic
1185957354 X:4506054-4506076 CTCACCCATTACTGCAAGGATGG + Intergenic
1186385568 X:9107183-9107205 CTCACTCATTACTGCAGGAAGGG - Intronic
1186547371 X:10464599-10464621 CTCCTTCATCTCTGCAATCAGGG + Intronic
1187810449 X:23170776-23170798 CTCACTCATTACCCCAAGAAAGG - Intergenic
1188080684 X:25836367-25836389 CACAATGATCTCTGCAATAAGGG + Intergenic
1188557411 X:31428229-31428251 CTCACTTATTACTGCAAGAATGG - Intronic
1189847179 X:45148603-45148625 CTCACTCATCACTTCCAGGAGGG + Exonic
1189918515 X:45880618-45880640 CTCATTCATTACTGCAAGAATGG - Intergenic
1189921460 X:45906897-45906919 AACATTCATCTCTGCAAGCAAGG + Intergenic
1190153495 X:47967806-47967828 CTCACTCATTATTGCAAGAATGG - Intronic
1192103214 X:68287617-68287639 CTCACCCATGGCTGCTAGAATGG + Intronic
1193013695 X:76707842-76707864 CTCCCTCAGCTCTCCTAGAATGG - Intergenic
1193110386 X:77723587-77723609 CTGACTCTTATCTGAAAGAATGG - Intronic
1194528781 X:95016404-95016426 CTTACGTAACTCTGCAAGAATGG + Intergenic
1195159944 X:102161552-102161574 CTCACACATTACTGCAAGAATGG + Intergenic
1195233957 X:102878636-102878658 CTCACTCATCACAGCAAGGATGG + Intergenic
1195300978 X:103529696-103529718 CTCACTCATCACAGCAAGGTTGG - Intergenic
1195580578 X:106496607-106496629 CTCACTCACTACTGGAAGAATGG - Intergenic
1196118445 X:112022514-112022536 CTCACTCATCCATGCAACACAGG - Intronic
1196561316 X:117152564-117152586 TTCACATATCTCTGTAAGAATGG + Intergenic
1198999830 X:142622147-142622169 CTTACTGATCTCTAAAAGAAAGG - Intergenic
1199785056 X:151097923-151097945 CTCACTAATCTCTACAAGGAAGG - Intergenic
1199938902 X:152605098-152605120 CCCAGTCACCTCTGCAAAAATGG - Intergenic
1200204779 X:154308043-154308065 CTCGCTCATCTCTGCTCGAATGG + Intronic
1201494562 Y:14578997-14579019 ATCACACATCTTTCCAAGAAGGG - Intronic
1201745706 Y:17370978-17371000 CTCACCCATTACTGCAAGGATGG + Intergenic
1201974307 Y:19831861-19831883 CTCTCTCATCTCTGCACACAGGG - Intergenic