ID: 1123782900

View in Genome Browser
Species Human (GRCh38)
Location 15:23645081-23645103
Sequence TCCGGGTGGCCTTGCCGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123782897_1123782900 -8 Left 1123782897 15:23645066-23645088 CCAGATGCTTCTTCTTCCGGGTG 0: 1
1: 0
2: 0
3: 4
4: 132
Right 1123782900 15:23645081-23645103 TCCGGGTGGCCTTGCCGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 84
1123782894_1123782900 4 Left 1123782894 15:23645054-23645076 CCTCTTGGGCTTCCAGATGCTTC 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1123782900 15:23645081-23645103 TCCGGGTGGCCTTGCCGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 84
1123782893_1123782900 14 Left 1123782893 15:23645044-23645066 CCACGGCTGTCCTCTTGGGCTTC 0: 1
1: 1
2: 2
3: 18
4: 217
Right 1123782900 15:23645081-23645103 TCCGGGTGGCCTTGCCGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123782900 Original CRISPR TCCGGGTGGCCTTGCCGGAG CGG Exonic
906056998 1:42925027-42925049 TCCGGGTCCCCGTGCGGGAGGGG - Intergenic
914095960 1:144544580-144544602 GCCAGGTTGCCCTGCCGGAGGGG - Intergenic
922416638 1:225428135-225428157 CCCGGGCGGCCTCGCCGGTGGGG - Intronic
922526752 1:226309578-226309600 TCTGGGTCGCATTGCCCGAGGGG + Exonic
923041684 1:230324110-230324132 TCTGGGTGGGCTTCCCGGAGGGG - Intronic
1063663597 10:8049532-8049554 TCCGGGGCGCCCTGCCGCAGCGG + Intergenic
1071520792 10:86330434-86330456 TGTGGGTGGGCTTGCTGGAGGGG - Intronic
1072565513 10:96613748-96613770 TCTGGATGGCCCTGCCTGAGAGG + Intronic
1075802552 10:125161598-125161620 TCCGGGAGACCGTGCCGGAGAGG + Intergenic
1089418759 11:118315486-118315508 TCCCGCTGGCCTTTCCGGATGGG - Exonic
1096614125 12:52822103-52822125 TCAGGGCGGCCATGCCAGAGAGG + Intronic
1098045747 12:66398557-66398579 TCCTGGTGGCTTAGCTGGAGGGG + Intronic
1103363826 12:120368787-120368809 TCCGGGGTGCCCTGCCGGACCGG + Intronic
1105702052 13:22941096-22941118 TCCAGGTGGCCTGGCAGGCGAGG - Intergenic
1105854676 13:24362881-24362903 TCCGGGTGGCCTGGCAGGCAAGG - Intergenic
1113861676 13:113491026-113491048 TCCGGGTCGGCTTGGCTGAGCGG + Exonic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1113962013 13:114131524-114131546 TCCCGGAGGCGTTTCCGGAGAGG - Intronic
1120701805 14:87706308-87706330 GCCAAGTGGCCTTGCAGGAGAGG - Intergenic
1121959254 14:98243543-98243565 TCCATGTGGCCTGGCTGGAGTGG - Intergenic
1122355813 14:101122284-101122306 TCCTGGGGTCCTTGCCCGAGAGG + Intergenic
1122556990 14:102585819-102585841 TCGGGGTGGCCTTGTGGGAACGG + Intergenic
1122843529 14:104478103-104478125 TCCGGGTGGCCTGGCAGGCGAGG - Intronic
1122918718 14:104870854-104870876 TCAGGGAGGCCTTGCAGGTGTGG + Intronic
1123782900 15:23645081-23645103 TCCGGGTGGCCTTGCCGGAGCGG + Exonic
1128516018 15:68342347-68342369 CCTGGGTGGCCTTGCACGAGGGG + Intronic
1131132835 15:89911036-89911058 TCCCAGTGGCCTTGTAGGAGGGG - Intronic
1132518902 16:378504-378526 TCCGGGTGGCAGTGCGGGTGGGG - Intronic
1132849270 16:2017199-2017221 TCAGTGTGGCCTTCCTGGAGAGG + Intronic
1133769252 16:8858311-8858333 TCTGGGTGGCCTGGCTGGGGTGG - Intronic
1134523819 16:14929986-14930008 TGCTGGGGGCCTGGCCGGAGAGG + Intronic
1134549084 16:15130949-15130971 TGCTGGGGGCCTGGCCGGAGAGG - Intronic
1134711410 16:16328471-16328493 TGCTGGGGGCCTGGCCGGAGAGG + Intergenic
1134955419 16:18380222-18380244 TGCTGGGGGCCTGGCCGGAGAGG - Intergenic
1140409928 16:74735293-74735315 TCTTGGTGGCGTTGCCGGAGTGG + Intronic
1141799522 16:86297372-86297394 TCTGGGAGGCCTTGCCAAAGAGG - Intergenic
1141891404 16:86929057-86929079 GCCGGGAGGCCTTTCTGGAGAGG - Intergenic
1142171041 16:88622941-88622963 ACCGGGTGGCGCTGCCTGAGTGG - Intronic
1142354587 16:89596576-89596598 CCTGGGTGTCCCTGCCGGAGAGG + Exonic
1143732411 17:8888567-8888589 TCCGAGTGGCCTTGGAGGCGTGG - Exonic
1148641655 17:49192459-49192481 TCTGGGCGGCCTTTCCAGAGCGG - Intergenic
1151875230 17:76864246-76864268 TCCTGCTGGCCTGGCTGGAGGGG - Intergenic
1153202095 18:2656508-2656530 TACGGGAGGCCTTGCCGGCCCGG + Intronic
1157663858 18:49469068-49469090 TCCGGGTGACCTTGCCCTACAGG - Intergenic
1158878247 18:61752822-61752844 TCTAGGTGGCCTTGGTGGAGGGG + Intergenic
1160452453 18:78974532-78974554 GCCGGGTGGGCTCGCCGGCGTGG - Intergenic
1160504788 18:79420963-79420985 TCTAGGTGGCCCTGCTGGAGGGG - Intronic
1161768037 19:6217496-6217518 TCAGGGTGGCCTGCCTGGAGAGG + Intronic
1163559488 19:18010329-18010351 GGCTGGGGGCCTTGCCGGAGCGG + Exonic
1163797528 19:19346042-19346064 CCCTGGTGACCTTGCCCGAGTGG - Intronic
927839611 2:26431325-26431347 TCCGTGTGGCCTTGCAGATGGGG + Intronic
1174113827 20:48213784-48213806 CTGGGGTGGCCTTGCAGGAGGGG + Intergenic
1175984981 20:62760231-62760253 CGCGGGTGGCATTGCTGGAGAGG - Exonic
1179305078 21:40146246-40146268 CCCAGGTGGGCTTGACGGAGGGG + Intronic
1179561648 21:42219471-42219493 TCCAGGTGGCCCTGGCGGAGGGG - Intronic
1180342348 22:11628800-11628822 TCCGGGTGCCCTTGCCCTCGCGG + Intergenic
954395338 3:50290467-50290489 ACCAGGTGGCCTTGCAGGGGGGG - Exonic
956682860 3:71797648-71797670 TTCTGGTGGCCTTGCCAGTGGGG + Intergenic
961351584 3:126307861-126307883 TTCGGGTGGCCTGGCCTGGGGGG - Intergenic
961383303 3:126509757-126509779 TCCGGCTATCCTTGCCTGAGCGG - Intronic
963034517 3:141013787-141013809 TCTGGCTGGCCCTGCCGGAAAGG - Intergenic
964447075 3:156770689-156770711 TCCAGGTTGGCTTGCCTGAGAGG - Intergenic
969355244 4:6621197-6621219 TCCTGGTGGCCTCGAGGGAGAGG - Exonic
976704776 4:88008287-88008309 CCCGAGTGGCCTGGGCGGAGAGG + Exonic
994044872 5:95296296-95296318 CCTGGGTGGCCTTGCAGCAGAGG - Intergenic
994510752 5:100700649-100700671 TGCTGGTGACCTTGCTGGAGAGG - Intergenic
995325205 5:110882072-110882094 TCTGGGTGACCTTCCCTGAGTGG - Intergenic
996119137 5:119651444-119651466 CCCTGGTGGCCCTGCCGGAAGGG - Intergenic
997997608 5:138598987-138599009 ACCCAGTGGCCTTGCCAGAGAGG - Intergenic
1005533310 6:26730186-26730208 TCCGGGCGGCCTTGCCTGCAGGG + Intergenic
1005537484 6:26771478-26771500 TCCGGGCGGCCTTGCCTGCAGGG - Intergenic
1006904301 6:37522721-37522743 TTGGGGTGGCCTTGCTGGAGAGG + Intergenic
1009008359 6:57813888-57813910 TCCGGGTGGCCTTGCCTGCAGGG - Intergenic
1011641437 6:89419467-89419489 TCGGGGTGGGCTGGACGGAGTGG + Intergenic
1014162434 6:118185693-118185715 TCTAGGTGGCCTTGTCTGAGTGG - Intronic
1022284049 7:28938290-28938312 TGAGAGTGGCCTTGCTGGAGAGG - Intergenic
1023056141 7:36291563-36291585 TGTGGGTGGCCCTGCAGGAGAGG + Intronic
1023998839 7:45177991-45178013 TGCGGGTGGCCTGGCCTGGGGGG + Intronic
1025730455 7:64102676-64102698 ACAGGGTGGCCTTGGCAGAGTGG + Intronic
1029076141 7:97936027-97936049 GCCGGCTGGCCTTGCCGGCCGGG + Intergenic
1036260462 8:7235795-7235817 GCCGGCTGGCCTTGCCGGCCCGG + Intergenic
1036306151 8:7603727-7603749 GCCGGCTGGCCTTGCCGGCCGGG - Intergenic
1036312499 8:7694351-7694373 GCCGGCTGGCCTTGCCGGCCCGG + Intergenic
1036811081 8:11868046-11868068 AGCGGTTGGCGTTGCCGGAGCGG + Exonic
1047499482 8:125430642-125430664 TCCGGGAGCCCTTGCCTGCGGGG + Exonic
1049364162 8:142228629-142228651 TCAGGGTGGCCTTGCCCCAGTGG + Intronic
1049576003 8:143389898-143389920 CCAGGGTGGCATTGCCGGGGTGG + Intergenic
1054790791 9:69254424-69254446 TCCCGGCGGCCTGGCAGGAGTGG - Exonic
1061084689 9:128392158-128392180 TCCGGAGGGGCTTGCGGGAGGGG + Intergenic
1061175935 9:128997095-128997117 TCAGGGTGGCCTTCTCTGAGTGG + Intronic
1062399231 9:136365200-136365222 TCCAGGCTGCCTTGCCGGCGGGG - Exonic
1193083179 X:77425437-77425459 TCAGGGAGGCCTTTCTGGAGGGG + Intergenic
1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG + Intergenic