ID: 1123783120

View in Genome Browser
Species Human (GRCh38)
Location 15:23646036-23646058
Sequence CGGGGCCGGCAGCACAGGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123783113_1123783120 5 Left 1123783113 15:23646008-23646030 CCTGCGGGGCAGACAGTGGGGCA 0: 1
1: 0
2: 2
3: 21
4: 270
Right 1123783120 15:23646036-23646058 CGGGGCCGGCAGCACAGGCTGGG 0: 1
1: 1
2: 3
3: 24
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123783120 Original CRISPR CGGGGCCGGCAGCACAGGCT GGG Exonic