ID: 1123785020

View in Genome Browser
Species Human (GRCh38)
Location 15:23662976-23662998
Sequence CCCAGTGGACAGATGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123785015_1123785020 18 Left 1123785015 15:23662935-23662957 CCAATGAGTTAGGAGTACACAAA No data
Right 1123785020 15:23662976-23662998 CCCAGTGGACAGATGAAGGAAGG No data
1123785014_1123785020 19 Left 1123785014 15:23662934-23662956 CCCAATGAGTTAGGAGTACACAA No data
Right 1123785020 15:23662976-23662998 CCCAGTGGACAGATGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123785020 Original CRISPR CCCAGTGGACAGATGAAGGA AGG Intergenic
No off target data available for this crispr