ID: 1123786874

View in Genome Browser
Species Human (GRCh38)
Location 15:23683412-23683434
Sequence GCTGAAGCCCAGACTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123786874_1123786876 -8 Left 1123786874 15:23683412-23683434 CCCACAGCAGTCTGGGCTTCAGC No data
Right 1123786876 15:23683427-23683449 GCTTCAGCACACTGTCATGTTGG No data
1123786874_1123786877 7 Left 1123786874 15:23683412-23683434 CCCACAGCAGTCTGGGCTTCAGC No data
Right 1123786877 15:23683442-23683464 CATGTTGGACTGCAACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123786874 Original CRISPR GCTGAAGCCCAGACTGCTGT GGG (reversed) Intergenic
No off target data available for this crispr