ID: 1123786890

View in Genome Browser
Species Human (GRCh38)
Location 15:23683537-23683559
Sequence CTCTAAATAGAAAGACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123786890_1123786896 8 Left 1123786890 15:23683537-23683559 CCCTCCAGTCTTTCTATTTAGAG No data
Right 1123786896 15:23683568-23683590 GAAAACCCAAGAGAGCTGCTGGG No data
1123786890_1123786895 7 Left 1123786890 15:23683537-23683559 CCCTCCAGTCTTTCTATTTAGAG No data
Right 1123786895 15:23683567-23683589 TGAAAACCCAAGAGAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123786890 Original CRISPR CTCTAAATAGAAAGACTGGA GGG (reversed) Intergenic
No off target data available for this crispr