ID: 1123787863

View in Genome Browser
Species Human (GRCh38)
Location 15:23690550-23690572
Sequence CACTTCCCACTAGAGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123787863_1123787867 -3 Left 1123787863 15:23690550-23690572 CCCAGAGCCTCTAGTGGGAAGTG No data
Right 1123787867 15:23690570-23690592 GTGCGCATGCTCGCAGTGCAGGG No data
1123787863_1123787869 6 Left 1123787863 15:23690550-23690572 CCCAGAGCCTCTAGTGGGAAGTG No data
Right 1123787869 15:23690579-23690601 CTCGCAGTGCAGGGGCCCAGAGG No data
1123787863_1123787870 12 Left 1123787863 15:23690550-23690572 CCCAGAGCCTCTAGTGGGAAGTG No data
Right 1123787870 15:23690585-23690607 GTGCAGGGGCCCAGAGGCCCTGG No data
1123787863_1123787866 -4 Left 1123787863 15:23690550-23690572 CCCAGAGCCTCTAGTGGGAAGTG No data
Right 1123787866 15:23690569-23690591 AGTGCGCATGCTCGCAGTGCAGG No data
1123787863_1123787868 -2 Left 1123787863 15:23690550-23690572 CCCAGAGCCTCTAGTGGGAAGTG No data
Right 1123787868 15:23690571-23690593 TGCGCATGCTCGCAGTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123787863 Original CRISPR CACTTCCCACTAGAGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr