ID: 1123787977

View in Genome Browser
Species Human (GRCh38)
Location 15:23691223-23691245
Sequence TCATTGTATCCCCAGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123787977_1123787980 10 Left 1123787977 15:23691223-23691245 CCTTGTGCCTGGGGATACAATGA No data
Right 1123787980 15:23691256-23691278 GGTCTCTGTAATCTGTACTGAGG No data
1123787977_1123787982 18 Left 1123787977 15:23691223-23691245 CCTTGTGCCTGGGGATACAATGA No data
Right 1123787982 15:23691264-23691286 TAATCTGTACTGAGGGAAAGTGG No data
1123787977_1123787983 21 Left 1123787977 15:23691223-23691245 CCTTGTGCCTGGGGATACAATGA No data
Right 1123787983 15:23691267-23691289 TCTGTACTGAGGGAAAGTGGTGG No data
1123787977_1123787981 11 Left 1123787977 15:23691223-23691245 CCTTGTGCCTGGGGATACAATGA No data
Right 1123787981 15:23691257-23691279 GTCTCTGTAATCTGTACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123787977 Original CRISPR TCATTGTATCCCCAGGCACA AGG (reversed) Intergenic