ID: 1123787982

View in Genome Browser
Species Human (GRCh38)
Location 15:23691264-23691286
Sequence TAATCTGTACTGAGGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123787977_1123787982 18 Left 1123787977 15:23691223-23691245 CCTTGTGCCTGGGGATACAATGA No data
Right 1123787982 15:23691264-23691286 TAATCTGTACTGAGGGAAAGTGG No data
1123787978_1123787982 11 Left 1123787978 15:23691230-23691252 CCTGGGGATACAATGAGAAGTGA No data
Right 1123787982 15:23691264-23691286 TAATCTGTACTGAGGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123787982 Original CRISPR TAATCTGTACTGAGGGAAAG TGG Intergenic
No off target data available for this crispr