ID: 1123787983 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:23691267-23691289 |
Sequence | TCTGTACTGAGGGAAAGTGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1123787978_1123787983 | 14 | Left | 1123787978 | 15:23691230-23691252 | CCTGGGGATACAATGAGAAGTGA | No data | ||
Right | 1123787983 | 15:23691267-23691289 | TCTGTACTGAGGGAAAGTGGTGG | No data | ||||
1123787977_1123787983 | 21 | Left | 1123787977 | 15:23691223-23691245 | CCTTGTGCCTGGGGATACAATGA | No data | ||
Right | 1123787983 | 15:23691267-23691289 | TCTGTACTGAGGGAAAGTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1123787983 | Original CRISPR | TCTGTACTGAGGGAAAGTGG TGG | Intergenic | ||