ID: 1123788821

View in Genome Browser
Species Human (GRCh38)
Location 15:23699463-23699485
Sequence CTGCTATGATTCCGAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123788821_1123788826 11 Left 1123788821 15:23699463-23699485 CCATTTTTTCGGAATCATAGCAG No data
Right 1123788826 15:23699497-23699519 CCTGGCTGTAATGTCCCCATAGG 0: 11
1: 27
2: 63
3: 64
4: 166
1123788821_1123788824 -7 Left 1123788821 15:23699463-23699485 CCATTTTTTCGGAATCATAGCAG No data
Right 1123788824 15:23699479-23699501 ATAGCAGGAGAAGGCAATCCTGG 0: 68
1: 65
2: 22
3: 23
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123788821 Original CRISPR CTGCTATGATTCCGAAAAAA TGG (reversed) Intergenic
No off target data available for this crispr