ID: 1123813910

View in Genome Browser
Species Human (GRCh38)
Location 15:23957067-23957089
Sequence CTGCAGTAGTTGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123813907_1123813910 5 Left 1123813907 15:23957039-23957061 CCATACAAGCTTAAGAAGAATGT No data
Right 1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123813910 Original CRISPR CTGCAGTAGTTGAGGGAAGT AGG Intergenic
No off target data available for this crispr