ID: 1123816950

View in Genome Browser
Species Human (GRCh38)
Location 15:23990073-23990095
Sequence TGCTCCCCAGGTAACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123816947_1123816950 -2 Left 1123816947 15:23990052-23990074 CCAAAAAGTAGTTTCAATGGGTG No data
Right 1123816950 15:23990073-23990095 TGCTCCCCAGGTAACATGGAAGG No data
1123816944_1123816950 1 Left 1123816944 15:23990049-23990071 CCTCCAAAAAGTAGTTTCAATGG No data
Right 1123816950 15:23990073-23990095 TGCTCCCCAGGTAACATGGAAGG No data
1123816943_1123816950 24 Left 1123816943 15:23990026-23990048 CCACTCAAGATAGGGAGAGATGA No data
Right 1123816950 15:23990073-23990095 TGCTCCCCAGGTAACATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123816950 Original CRISPR TGCTCCCCAGGTAACATGGA AGG Intergenic
No off target data available for this crispr