ID: 1123817817

View in Genome Browser
Species Human (GRCh38)
Location 15:23997529-23997551
Sequence AGTTATCTGTGGATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123817812_1123817817 16 Left 1123817812 15:23997490-23997512 CCCAGTGACAAGCCAAGAGCTGC No data
Right 1123817817 15:23997529-23997551 AGTTATCTGTGGATGATGGCAGG No data
1123817814_1123817817 4 Left 1123817814 15:23997502-23997524 CCAAGAGCTGCTTATGAAAATAA No data
Right 1123817817 15:23997529-23997551 AGTTATCTGTGGATGATGGCAGG No data
1123817813_1123817817 15 Left 1123817813 15:23997491-23997513 CCAGTGACAAGCCAAGAGCTGCT No data
Right 1123817817 15:23997529-23997551 AGTTATCTGTGGATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123817817 Original CRISPR AGTTATCTGTGGATGATGGC AGG Intergenic
No off target data available for this crispr