ID: 1123821133

View in Genome Browser
Species Human (GRCh38)
Location 15:24031522-24031544
Sequence CAGAAAAAGGAAAAGGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123821129_1123821133 7 Left 1123821129 15:24031492-24031514 CCTCAGTAAAAGGTAAAAAGGAA No data
Right 1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123821133 Original CRISPR CAGAAAAAGGAAAAGGACTC AGG Intergenic
No off target data available for this crispr