ID: 1123825939

View in Genome Browser
Species Human (GRCh38)
Location 15:24082129-24082151
Sequence CAAAGAAAAAATCTGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123825939_1123825940 18 Left 1123825939 15:24082129-24082151 CCAGGCTTCAGATTTTTTCTTTG No data
Right 1123825940 15:24082170-24082192 CAGTTTTACCTTAAGCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123825939 Original CRISPR CAAAGAAAAAATCTGAAGCC TGG (reversed) Intergenic
No off target data available for this crispr