ID: 1123826067

View in Genome Browser
Species Human (GRCh38)
Location 15:24083509-24083531
Sequence TCACAGGTATGGTACCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123826067_1123826075 30 Left 1123826067 15:24083509-24083531 CCTAGCAGGTACCATACCTGTGA No data
Right 1123826075 15:24083562-24083584 AACCAGTTTCTCCAAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123826067 Original CRISPR TCACAGGTATGGTACCTGCT AGG (reversed) Intergenic
No off target data available for this crispr