ID: 1123827176

View in Genome Browser
Species Human (GRCh38)
Location 15:24093734-24093756
Sequence CACAATGCTGATAGTGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123827176_1123827179 3 Left 1123827176 15:24093734-24093756 CCCATGTCACTATCAGCATTGTG No data
Right 1123827179 15:24093760-24093782 ACAACAATTTAACCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123827176 Original CRISPR CACAATGCTGATAGTGACAT GGG (reversed) Intergenic
No off target data available for this crispr