ID: 1123829358

View in Genome Browser
Species Human (GRCh38)
Location 15:24118245-24118267
Sequence CAACCTTGGTGGGAATGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123829358_1123829365 -9 Left 1123829358 15:24118245-24118267 CCACTCCATTCCCACCAAGGTTG No data
Right 1123829365 15:24118259-24118281 CCAAGGTTGCCACAGTCTAGGGG No data
1123829358_1123829363 -10 Left 1123829358 15:24118245-24118267 CCACTCCATTCCCACCAAGGTTG No data
Right 1123829363 15:24118258-24118280 ACCAAGGTTGCCACAGTCTAGGG No data
1123829358_1123829367 30 Left 1123829358 15:24118245-24118267 CCACTCCATTCCCACCAAGGTTG No data
Right 1123829367 15:24118298-24118320 AAAGTTGAGTTCACATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123829358 Original CRISPR CAACCTTGGTGGGAATGGAG TGG (reversed) Intergenic
No off target data available for this crispr