ID: 1123829363

View in Genome Browser
Species Human (GRCh38)
Location 15:24118258-24118280
Sequence ACCAAGGTTGCCACAGTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123829358_1123829363 -10 Left 1123829358 15:24118245-24118267 CCACTCCATTCCCACCAAGGTTG No data
Right 1123829363 15:24118258-24118280 ACCAAGGTTGCCACAGTCTAGGG No data
1123829356_1123829363 -3 Left 1123829356 15:24118238-24118260 CCTGTGTCCACTCCATTCCCACC No data
Right 1123829363 15:24118258-24118280 ACCAAGGTTGCCACAGTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123829363 Original CRISPR ACCAAGGTTGCCACAGTCTA GGG Intergenic
No off target data available for this crispr