ID: 1123830288

View in Genome Browser
Species Human (GRCh38)
Location 15:24129033-24129055
Sequence AGAATGGTGTGAACCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123830282_1123830288 3 Left 1123830282 15:24129007-24129029 CCAGCTACTGGGGAGGCTGAGGC 0: 7331
1: 191434
2: 257382
3: 186144
4: 172266
Right 1123830288 15:24129033-24129055 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1123830278_1123830288 12 Left 1123830278 15:24128998-24129020 CCTCTAGTCCCAGCTACTGGGGA 0: 51
1: 5218
2: 118268
3: 249523
4: 247787
Right 1123830288 15:24129033-24129055 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1123830280_1123830288 4 Left 1123830280 15:24129006-24129028 CCCAGCTACTGGGGAGGCTGAGG 0: 8432
1: 209715
2: 276314
3: 184909
4: 196076
Right 1123830288 15:24129033-24129055 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123830288 Original CRISPR AGAATGGTGTGAACCCCAGG GGG Intergenic
Too many off-targets to display for this crispr