ID: 1123830978

View in Genome Browser
Species Human (GRCh38)
Location 15:24136837-24136859
Sequence TTAAAACCCTGCTTTCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123830978_1123830983 22 Left 1123830978 15:24136837-24136859 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123830983 15:24136882-24136904 GGTATGCAGAAGGAACATGGAGG No data
1123830978_1123830985 28 Left 1123830978 15:24136837-24136859 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123830985 15:24136888-24136910 CAGAAGGAACATGGAGGTGTGGG No data
1123830978_1123830984 27 Left 1123830978 15:24136837-24136859 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123830984 15:24136887-24136909 GCAGAAGGAACATGGAGGTGTGG No data
1123830978_1123830981 12 Left 1123830978 15:24136837-24136859 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123830981 15:24136872-24136894 TCTTGTGCAGGGTATGCAGAAGG No data
1123830978_1123830986 29 Left 1123830978 15:24136837-24136859 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123830986 15:24136889-24136911 AGAAGGAACATGGAGGTGTGGGG No data
1123830978_1123830980 1 Left 1123830978 15:24136837-24136859 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123830980 15:24136861-24136883 AAGAGAAACTTTCTTGTGCAGGG No data
1123830978_1123830982 19 Left 1123830978 15:24136837-24136859 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG No data
1123830978_1123830979 0 Left 1123830978 15:24136837-24136859 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123830979 15:24136860-24136882 GAAGAGAAACTTTCTTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123830978 Original CRISPR TTAAAACCCTGCTTTCTTCC CGG (reversed) Intergenic
No off target data available for this crispr