ID: 1123830982

View in Genome Browser
Species Human (GRCh38)
Location 15:24136879-24136901
Sequence CAGGGTATGCAGAAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123830978_1123830982 19 Left 1123830978 15:24136837-24136859 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123830982 Original CRISPR CAGGGTATGCAGAAGGAACA TGG Intergenic
No off target data available for this crispr