ID: 1123832155

View in Genome Browser
Species Human (GRCh38)
Location 15:24151083-24151105
Sequence AAATCTGTAGAGAAGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123832155_1123832159 17 Left 1123832155 15:24151083-24151105 CCTTGTACCTTCTCTACAGATTT No data
Right 1123832159 15:24151123-24151145 AAAGCATGTTACCTTCTGACAGG No data
1123832155_1123832160 23 Left 1123832155 15:24151083-24151105 CCTTGTACCTTCTCTACAGATTT No data
Right 1123832160 15:24151129-24151151 TGTTACCTTCTGACAGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123832155 Original CRISPR AAATCTGTAGAGAAGGTACA AGG (reversed) Intergenic
No off target data available for this crispr