ID: 1123832368

View in Genome Browser
Species Human (GRCh38)
Location 15:24154008-24154030
Sequence CTCCTCCATGTTCCTCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123832363_1123832368 1 Left 1123832363 15:24153984-24154006 CCATGACATTTTCCAGTTTGTGG No data
Right 1123832368 15:24154008-24154030 CTCCTCCATGTTCCTCAAGGTGG No data
1123832362_1123832368 22 Left 1123832362 15:24153963-24153985 CCAGAAATAGGGTTTAGAAATCC No data
Right 1123832368 15:24154008-24154030 CTCCTCCATGTTCCTCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123832368 Original CRISPR CTCCTCCATGTTCCTCAAGG TGG Intergenic
No off target data available for this crispr