ID: 1123833351

View in Genome Browser
Species Human (GRCh38)
Location 15:24164301-24164323
Sequence CCACACTAGCAGCCAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123833351_1123833356 1 Left 1123833351 15:24164301-24164323 CCTTAGCCTGGCTGCTAGTGTGG No data
Right 1123833356 15:24164325-24164347 GTGTGTTGCTCTTGTGTTTTTGG No data
1123833351_1123833357 12 Left 1123833351 15:24164301-24164323 CCTTAGCCTGGCTGCTAGTGTGG No data
Right 1123833357 15:24164336-24164358 TTGTGTTTTTGGATGCGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123833351 Original CRISPR CCACACTAGCAGCCAGGCTA AGG (reversed) Intergenic
No off target data available for this crispr