ID: 1123833676

View in Genome Browser
Species Human (GRCh38)
Location 15:24167091-24167113
Sequence GCTACTGTGACCTGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123833676_1123833685 29 Left 1123833676 15:24167091-24167113 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573
1123833676_1123833684 28 Left 1123833676 15:24167091-24167113 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123833676 Original CRISPR GCTACTGTGACCTGGGCGGC GGG (reversed) Intergenic
No off target data available for this crispr