ID: 1123833684

View in Genome Browser
Species Human (GRCh38)
Location 15:24167142-24167164
Sequence TGTATATTTCTTGTTTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 849
Summary {0: 1, 1: 1, 2: 5, 3: 61, 4: 781}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123833678_1123833684 24 Left 1123833678 15:24167095-24167117 CCGCCCAGGTCACAGTAGCCCCT No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781
1123833679_1123833684 21 Left 1123833679 15:24167098-24167120 CCCAGGTCACAGTAGCCCCTTCT No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781
1123833682_1123833684 5 Left 1123833682 15:24167114-24167136 CCCTTCTATTTTTTCTATATGCA No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781
1123833680_1123833684 20 Left 1123833680 15:24167099-24167121 CCAGGTCACAGTAGCCCCTTCTA No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781
1123833681_1123833684 6 Left 1123833681 15:24167113-24167135 CCCCTTCTATTTTTTCTATATGC No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781
1123833675_1123833684 29 Left 1123833675 15:24167090-24167112 CCCCGCCGCCCAGGTCACAGTAG No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781
1123833677_1123833684 27 Left 1123833677 15:24167092-24167114 CCGCCGCCCAGGTCACAGTAGCC No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781
1123833683_1123833684 4 Left 1123833683 15:24167115-24167137 CCTTCTATTTTTTCTATATGCAC No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781
1123833676_1123833684 28 Left 1123833676 15:24167091-24167113 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123833684 15:24167142-24167164 TGTATATTTCTTGTTTTTCCTGG 0: 1
1: 1
2: 5
3: 61
4: 781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123833684 Original CRISPR TGTATATTTCTTGTTTTTCC TGG Intergenic