ID: 1123833685

View in Genome Browser
Species Human (GRCh38)
Location 15:24167143-24167165
Sequence GTATATTTCTTGTTTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 1, 2: 3, 3: 50, 4: 573}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123833682_1123833685 6 Left 1123833682 15:24167114-24167136 CCCTTCTATTTTTTCTATATGCA No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573
1123833679_1123833685 22 Left 1123833679 15:24167098-24167120 CCCAGGTCACAGTAGCCCCTTCT No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573
1123833675_1123833685 30 Left 1123833675 15:24167090-24167112 CCCCGCCGCCCAGGTCACAGTAG No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573
1123833677_1123833685 28 Left 1123833677 15:24167092-24167114 CCGCCGCCCAGGTCACAGTAGCC No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573
1123833676_1123833685 29 Left 1123833676 15:24167091-24167113 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573
1123833678_1123833685 25 Left 1123833678 15:24167095-24167117 CCGCCCAGGTCACAGTAGCCCCT No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573
1123833680_1123833685 21 Left 1123833680 15:24167099-24167121 CCAGGTCACAGTAGCCCCTTCTA No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573
1123833683_1123833685 5 Left 1123833683 15:24167115-24167137 CCTTCTATTTTTTCTATATGCAC No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573
1123833681_1123833685 7 Left 1123833681 15:24167113-24167135 CCCCTTCTATTTTTTCTATATGC No data
Right 1123833685 15:24167143-24167165 GTATATTTCTTGTTTTTCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123833685 Original CRISPR GTATATTTCTTGTTTTTCCT GGG Intergenic