ID: 1123836064

View in Genome Browser
Species Human (GRCh38)
Location 15:24194254-24194276
Sequence CAGGGTATGCAGAAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123836060_1123836064 19 Left 1123836060 15:24194212-24194234 CCGGGAAGAAAGCAGGGTTTTAA No data
Right 1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123836064 Original CRISPR CAGGGTATGCAGAAGGAACA TGG Intergenic
No off target data available for this crispr