ID: 1123836412

View in Genome Browser
Species Human (GRCh38)
Location 15:24198397-24198419
Sequence TTTATAGAAGGTCCATCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123836412_1123836415 19 Left 1123836412 15:24198397-24198419 CCTATGGATGGACCTTCTATAAA No data
Right 1123836415 15:24198439-24198461 AAAAATATTTAACATTCCTTGGG No data
1123836412_1123836414 18 Left 1123836412 15:24198397-24198419 CCTATGGATGGACCTTCTATAAA No data
Right 1123836414 15:24198438-24198460 AAAAAATATTTAACATTCCTTGG No data
1123836412_1123836416 28 Left 1123836412 15:24198397-24198419 CCTATGGATGGACCTTCTATAAA No data
Right 1123836416 15:24198448-24198470 TAACATTCCTTGGGCTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123836412 Original CRISPR TTTATAGAAGGTCCATCCAT AGG (reversed) Intergenic
No off target data available for this crispr