ID: 1123840079

View in Genome Browser
Species Human (GRCh38)
Location 15:24239380-24239402
Sequence CCACACTAGCAGCCAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123840079_1123840084 1 Left 1123840079 15:24239380-24239402 CCTTAGCCTGGCTGCTAGTGTGG No data
Right 1123840084 15:24239404-24239426 GTGTGTTGCTCTTGTGTTTTTGG No data
1123840079_1123840085 12 Left 1123840079 15:24239380-24239402 CCTTAGCCTGGCTGCTAGTGTGG No data
Right 1123840085 15:24239415-24239437 TTGTGTTTTTGGATGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123840079 Original CRISPR CCACACTAGCAGCCAGGCTA AGG (reversed) Intergenic
No off target data available for this crispr