ID: 1123840416

View in Genome Browser
Species Human (GRCh38)
Location 15:24242127-24242149
Sequence GCTACTGTGACCTGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123840416_1123840424 7 Left 1123840416 15:24242127-24242149 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123840424 15:24242157-24242179 ATTTTTTCTATATGCACTCACGG No data
1123840416_1123840425 27 Left 1123840416 15:24242127-24242149 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123840416 Original CRISPR GCTACTGTGACCTGGGCGGC GGG (reversed) Intergenic