ID: 1123840424

View in Genome Browser
Species Human (GRCh38)
Location 15:24242157-24242179
Sequence ATTTTTTCTATATGCACTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123840419_1123840424 0 Left 1123840419 15:24242134-24242156 CCCAGGTCACAGTAGCCCCTTCT No data
Right 1123840424 15:24242157-24242179 ATTTTTTCTATATGCACTCACGG No data
1123840417_1123840424 6 Left 1123840417 15:24242128-24242150 CCGCCGCCCAGGTCACAGTAGCC No data
Right 1123840424 15:24242157-24242179 ATTTTTTCTATATGCACTCACGG No data
1123840414_1123840424 11 Left 1123840414 15:24242123-24242145 CCTCCCCGCCGCCCAGGTCACAG No data
Right 1123840424 15:24242157-24242179 ATTTTTTCTATATGCACTCACGG No data
1123840415_1123840424 8 Left 1123840415 15:24242126-24242148 CCCCGCCGCCCAGGTCACAGTAG No data
Right 1123840424 15:24242157-24242179 ATTTTTTCTATATGCACTCACGG No data
1123840420_1123840424 -1 Left 1123840420 15:24242135-24242157 CCAGGTCACAGTAGCCCCTTCTA No data
Right 1123840424 15:24242157-24242179 ATTTTTTCTATATGCACTCACGG No data
1123840418_1123840424 3 Left 1123840418 15:24242131-24242153 CCGCCCAGGTCACAGTAGCCCCT No data
Right 1123840424 15:24242157-24242179 ATTTTTTCTATATGCACTCACGG No data
1123840413_1123840424 14 Left 1123840413 15:24242120-24242142 CCTCCTCCCCGCCGCCCAGGTCA No data
Right 1123840424 15:24242157-24242179 ATTTTTTCTATATGCACTCACGG No data
1123840416_1123840424 7 Left 1123840416 15:24242127-24242149 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123840424 15:24242157-24242179 ATTTTTTCTATATGCACTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123840424 Original CRISPR ATTTTTTCTATATGCACTCA CGG Intergenic