ID: 1123840425

View in Genome Browser
Species Human (GRCh38)
Location 15:24242177-24242199
Sequence CGGTATTTTTTGTTTTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123840423_1123840425 3 Left 1123840423 15:24242151-24242173 CCTTCTATTTTTTCTATATGCAC No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data
1123840415_1123840425 28 Left 1123840415 15:24242126-24242148 CCCCGCCGCCCAGGTCACAGTAG No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data
1123840421_1123840425 5 Left 1123840421 15:24242149-24242171 CCCCTTCTATTTTTTCTATATGC No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data
1123840419_1123840425 20 Left 1123840419 15:24242134-24242156 CCCAGGTCACAGTAGCCCCTTCT No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data
1123840418_1123840425 23 Left 1123840418 15:24242131-24242153 CCGCCCAGGTCACAGTAGCCCCT No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data
1123840420_1123840425 19 Left 1123840420 15:24242135-24242157 CCAGGTCACAGTAGCCCCTTCTA No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data
1123840422_1123840425 4 Left 1123840422 15:24242150-24242172 CCCTTCTATTTTTTCTATATGCA No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data
1123840416_1123840425 27 Left 1123840416 15:24242127-24242149 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data
1123840417_1123840425 26 Left 1123840417 15:24242128-24242150 CCGCCGCCCAGGTCACAGTAGCC No data
Right 1123840425 15:24242177-24242199 CGGTATTTTTTGTTTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123840425 Original CRISPR CGGTATTTTTTGTTTTTCCT TGG Intergenic